The 33 references with contexts in paper L. Salnikova Ye., T. Smelaya V., V. Moroz V., A. Golubev M., N. Ponasenkov Kh., R. Khomenko V., I. Kharlamova V., N. Lapteva Sh., G. Kuznetsova I., G. Poroshenko G., A. Rubanovich V., Л. Сальникова Е., Т. Смелая В., В. Мороз В, А. Голубев М, Н. Понасенков Х., Р. Хоменко В., И. Харламова Е., Н. Лаптева Ш., Г. Кузнецова И., Г. Порошенко Г., А. Рубанович В. (2008) “Гены детоксикации ксенобиотиков и их роль в развитии пневмонии // Xenobiotic Detoxification Genes and Their Role in the Development of Pneumonia” / spz:neicon:reanimatology:634

1
Чучалин А. Г., Синопальников А. И., Стручинский Л. С. и соавт.Вне! больничная пневмония у взрослых: практические рекомендации по диагностике, лечению и профилактике. Клин. микроб. антимикроб. химиотер. 2006; 8: 54—86.
Total in-text references: 5
  1. In-text reference with the coordinate start=4012
    Prefix
    (2B), NP does not develop statistically significantly in 61.1% of cases with the GSTM1 + GSTT1+ genotype versus 38.8% in the controls (p=0.022) or versus 37.5% in subgroup 2A (p=0.045; OR=2.6). Key words:acute communityWacquired pneumonia, nosocomial pneumonia, gene polymorphism. Пневмония по!прежнему занимает 1!е место в структуре причин смерти среди инфекционных болез! ней
    Exact
    [1]
    Suffix
    . В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией [2, 3], 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5% [1, 4]. В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии [1].

  2. In-text reference with the coordinate start=4186
    Prefix
    Пневмония по!прежнему занимает 1!е место в структуре причин смерти среди инфекционных болез! ней [1]. В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией [2, 3], 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5%
    Exact
    [1, 4]
    Suffix
    . В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии [1]. В Рос! сии заболеваемость колеблется в пределах 10—14 человек, а в других развитых странах мира — от 3,6 до 16 человек на 1000 человек в год.

  3. In-text reference with the coordinate start=4312
    Prefix
    В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией [2, 3], 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5% [1, 4]. В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии
    Exact
    [1]
    Suffix
    . В Рос! сии заболеваемость колеблется в пределах 10—14 человек, а в других развитых странах мира — от 3,6 до 16 человек на 1000 человек в год. В крупных городах Рос! сии с 1990 г. заболеваемость пневмонией возросла в 4 раза, а летальность при ней — в 3 раза [1].

  4. In-text reference with the coordinate start=4575
    Prefix
    В Рос! сии заболеваемость колеблется в пределах 10—14 человек, а в других развитых странах мира — от 3,6 до 16 человек на 1000 человек в год. В крупных городах Рос! сии с 1990 г. заболеваемость пневмонией возросла в 4 раза, а летальность при ней — в 3 раза
    Exact
    [1]
    Suffix
    . Высокие по! казатели заболеваемости пневмонией регистрируют среди воинских контингентов. В Вооруженных Силах РФ средняя заболеваемость пневмонией у военнослу! жащих, проходивших службу по призыву, за 25!летний период составила 12,5% [5].

  5. In-text reference with the coordinate start=9955
    Prefix
    Степень тяжести больных с ВП определяли на основании размеров пневмонической инфиль! трации, выраженности интоксикации, степени нарушения функций дыхательной и сердечно!сосудистой систем (Приказ МЗ РФ No 300 от 9 октября 1998 г.)
    Exact
    [1]
    Suffix
    . В соответствии с оп! ределениями зарубежных и российских авторов, нозокоми! альной мы считали пневмонию, развившуюся спустя 48 часов и более от момента госпитализации [23, 24]. С помощью шка! лы Clinical Pulmonary Infection Score (CPIS) [25] оценивали тяжесть пневмонии.

2
Bartlett J. G., Dowell S. F., Mandell L. A. et al.Practtice guidelines for the management of community!acquired pneumonia in adults. Clin. Infect. Dis. 2000; 31: 347—382.
Total in-text references: 1
  1. In-text reference with the coordinate start=4096
    Prefix
    Key words:acute communityWacquired pneumonia, nosocomial pneumonia, gene polymorphism. Пневмония по!прежнему занимает 1!е место в структуре причин смерти среди инфекционных болез! ней [1]. В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией
    Exact
    [2, 3]
    Suffix
    , 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5% [1, 4]. В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии [1].

3
Niedermann M. S., Mandell L. A., Anzueto A. et al.Guidelines for the management of community!acquired pneumonia. Diagnosis, assessment of severity, antimicrobial therapy and prevention. Am. J. Respir. Crit. Care Med. 2001; 163: 1730—1754.
Total in-text references: 1
  1. In-text reference with the coordinate start=4096
    Prefix
    Key words:acute communityWacquired pneumonia, nosocomial pneumonia, gene polymorphism. Пневмония по!прежнему занимает 1!е место в структуре причин смерти среди инфекционных болез! ней [1]. В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией
    Exact
    [2, 3]
    Suffix
    , 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5% [1, 4]. В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии [1].

4
American thoracic society. Guidelines for the initial management of adults with community!acquired pneumonia. Diagnosis assesment of severity and initial antimicrobial therapy. Amer. Rev. Resp. Dis. 1993; 148 (5): 1418—1426.
Total in-text references: 1
  1. In-text reference with the coordinate start=4186
    Prefix
    Пневмония по!прежнему занимает 1!е место в структуре причин смерти среди инфекционных болез! ней [1]. В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией [2, 3], 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5%
    Exact
    [1, 4]
    Suffix
    . В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии [1]. В Рос! сии заболеваемость колеблется в пределах 10—14 человек, а в других развитых странах мира — от 3,6 до 16 человек на 1000 человек в год.

5
Чучалин А. Г., Синопальникова А. И.(ред.) Клинические рекомен! дации. Внебольничная пневмония у взрослых. М.: Атмосфера; 2005.
Total in-text references: 1
  1. In-text reference with the coordinate start=4816
    Prefix
    Высокие по! казатели заболеваемости пневмонией регистрируют среди воинских контингентов. В Вооруженных Силах РФ средняя заболеваемость пневмонией у военнослу! жащих, проходивших службу по призыву, за 25!летний период составила 12,5%
    Exact
    [5]
    Suffix
    . В 2002 г. уровень заболева! емости пневмонией возрос, по сравнению с таковыми в 2001 г., на 2,1% — с 43,8 до 44,7‰ [6]. Традиционно подъем заболеваемости острыми респираторными ви! русными инфекциями, бронхитами и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, э

6
Раков А. Л., Комаревцев В. Н., Харитонов М. А., Казанцев В. А.Осо! бенности внебольничной пневмонии у военнослужащих в период вооруженного конфликта на Северном Кавказе в 1995—1996 гг. ВМЖ 2005; 7: 23—30.
Total in-text references: 2
  1. In-text reference with the coordinate start=4936
    Prefix
    В Вооруженных Силах РФ средняя заболеваемость пневмонией у военнослу! жащих, проходивших службу по призыву, за 25!летний период составила 12,5% [5]. В 2002 г. уровень заболева! емости пневмонией возрос, по сравнению с таковыми в 2001 г., на 2,1% — с 43,8 до 44,7‰
    Exact
    [6]
    Suffix
    . Традиционно подъем заболеваемости острыми респираторными ви! русными инфекциями, бронхитами и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, эколо! гических и других факторов) [7, 8].

  2. In-text reference with the coordinate start=5403
    Prefix
    и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, эколо! гических и других факторов) [7, 8]. Ежегодно в отдель! ных учебных центрах некоторых военных округов у молодого пополнения регистрируют эпидемические вспышки пневмонии с ростом заболеваемости до 250‰ и выше
    Exact
    [6, 9]
    Suffix
    . Немаловажное значение придается госпитальной (нозокомиальной) пневмонии (НП), составляющей 10—15% от всех госпитальных инфекций. Летальность от НП составляет от 30—60 до 80% [10]. Не вызывает сомнений тот факт, что помимо свойств возбудителя заболевания, на развитие и исход любого инфекционного процесса и пневмонии, в том числе, влияет и сопротивляемость организма,

7
Кацуба А. М., Королева Е. Б., Щекин В. М., Волков К. Л. Актуальные вопросы квалифицированной и специализированной пульмонологи! ческой помощи больным пневмонией в условиях базового гарнизон! ного госпиталя. В кн.: Тез. науч.!практич. конфер. М.: 2000. 17—19.
Total in-text references: 1
  1. In-text reference with the coordinate start=5227
    Prefix
    Традиционно подъем заболеваемости острыми респираторными ви! русными инфекциями, бронхитами и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, эколо! гических и других факторов)
    Exact
    [7, 8]
    Suffix
    . Ежегодно в отдель! ных учебных центрах некоторых военных округов у молодого пополнения регистрируют эпидемические вспышки пневмонии с ростом заболеваемости до 250‰ и выше [6, 9]. Немаловажное значение придается госпитальной (нозокомиальной) пневмонии (НП), составляющей 10—15% от всех госпитальных инфекций.

8
Сиротко И. И.Клинико!эпидемиологические особенности острых бронхолегочных заболеваний у лиц молодого возраста в организо! ванных коллективах: автореф. дис. ... д!ра мед.наук. Самара; 2001.
Total in-text references: 1
  1. In-text reference with the coordinate start=5227
    Prefix
    Традиционно подъем заболеваемости острыми респираторными ви! русными инфекциями, бронхитами и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, эколо! гических и других факторов)
    Exact
    [7, 8]
    Suffix
    . Ежегодно в отдель! ных учебных центрах некоторых военных округов у молодого пополнения регистрируют эпидемические вспышки пневмонии с ростом заболеваемости до 250‰ и выше [6, 9]. Немаловажное значение придается госпитальной (нозокомиальной) пневмонии (НП), составляющей 10—15% от всех госпитальных инфекций.

9
Гучев И. А. , Синопальников А. И. , Ульянов В. А. , Клочков О. И.Совре! менные подходы к ведению больных внебольничными пневмония! ми в воинских коллективах. ВМЖ 2001; 322 (11): 29—35.
Total in-text references: 1
  1. In-text reference with the coordinate start=5403
    Prefix
    и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, эколо! гических и других факторов) [7, 8]. Ежегодно в отдель! ных учебных центрах некоторых военных округов у молодого пополнения регистрируют эпидемические вспышки пневмонии с ростом заболеваемости до 250‰ и выше
    Exact
    [6, 9]
    Suffix
    . Немаловажное значение придается госпитальной (нозокомиальной) пневмонии (НП), составляющей 10—15% от всех госпитальных инфекций. Летальность от НП составляет от 30—60 до 80% [10]. Не вызывает сомнений тот факт, что помимо свойств возбудителя заболевания, на развитие и исход любого инфекционного процесса и пневмонии, в том числе, влияет и сопротивляемость организма,

10
Hospital!acquired pneumonia guideline committee of the American thoracic sosiety & infectious diseases society of America. Guidelines for the management of adults with hospital!acquired, ventilator!associat! ed, and healthcare!associated pneumonia. Am. J. Respir. Crit. Care Med. 2005; 17: 388—416.
Total in-text references: 1
  1. In-text reference with the coordinate start=5590
    Prefix
    Ежегодно в отдель! ных учебных центрах некоторых военных округов у молодого пополнения регистрируют эпидемические вспышки пневмонии с ростом заболеваемости до 250‰ и выше [6, 9]. Немаловажное значение придается госпитальной (нозокомиальной) пневмонии (НП), составляющей 10—15% от всех госпитальных инфекций. Летальность от НП составляет от 30—60 до 80%
    Exact
    [10]
    Suffix
    . Не вызывает сомнений тот факт, что помимо свойств возбудителя заболевания, на развитие и исход любого инфекционного процесса и пневмонии, в том числе, влияет и сопротивляемость организма, определя! емая его генетическим статусом.

11
To b i n M . J .Pediatrics, surfactant, and cystic fibrosis in AJRCCM 2002. Am. J. Respir. Crit. Care Med. 2003; 167: 333—344.
Total in-text references: 1
  1. In-text reference with the coordinate start=6154
    Prefix
    Течение многих острых заболеваний, возникнове! ние осложнений зависят от генов!кандидатов, наиболее изученными из которых являются гены цитокинов и ге! ны детоксикации ксенобиотиков. В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция
    Exact
    [11]
    Suffix
    , острый панкреатит [12], периодонтит [13], острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18].

12
Rahman S. H., Ibrahim K., Larvin M., McMahon M. J. The null polymor! phism of the glutathione!S!transferase gene (GST!T1) is protective in acute pancreatitis. British J. Surgery 2001; 88 (1): 1—2.
Total in-text references: 1
  1. In-text reference with the coordinate start=6181
    Prefix
    Течение многих острых заболеваний, возникнове! ние осложнений зависят от генов!кандидатов, наиболее изученными из которых являются гены цитокинов и ге! ны детоксикации ксенобиотиков. В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит
    Exact
    [12]
    Suffix
    , периодонтит [13], острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18].

13
Concolinoa P., Cecchettic F., D'Autiliad C. et al.Association of periodon! titis with GSTM1/GSTT1!null variants!A pilot study. Clinical Biochemistry 2007; 40 (13—14): 939—945.
Total in-text references: 1
  1. In-text reference with the coordinate start=6198
    Prefix
    В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит [12], периодонтит
    Exact
    [13]
    Suffix
    , острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18].

14
Mittal R. D., Manchanda P. K., Bid H. K., Ghoshal U. C.Analysis of poly! morphisms of tumor necrosis factor!alpha and polymorphic xenobiotic metabolizing enzymes in inflammatory bowel disease: study from north! ern India. J. Gastroenterol. Hepatol. 2007; 22 (6): 920—924.
Total in-text references: 1
  1. In-text reference with the coordinate start=6229
    Prefix
    В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит [12], периодонтит [13], острая патология кишечника
    Exact
    [14]
    Suffix
    . Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18].

15
Баранов В. С., Баранова Е. В., Иващенко Т. Э., Асеев М. В.Геном че! ловека и гены «предрасположенности». Введение в предиктивную медицину. СПб.: Интермедика; 2000.
Total in-text references: 4
  1. In-text reference with the coordinate start=6346
    Prefix
    В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит [12], периодонтит [13], острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы
    Exact
    [15]
    Suffix
    , хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST) [19, 20] — генов второй фазы деток! сикации ксенобиотиков.

  2. In-text reference with the coordinate start=7150
    Prefix
    Глутатионтрансферазы катали! зируют реакцию глутамата с различными органическими радикалами и играют ключевую роль в обеспечении рези! стентности клеток к перекисному окислению жиров, сво! бодным радикалам, алкилированию белков и в предот! вращении поломок ДНК
    Exact
    [15]
    Suffix
    . Важная функция генов детоксикации ксенобиотиков — взаимодействие с эндо! генными факторами, для глутатионтрансфераз эндоген! ными субстратами являются билирубин и гормоны, уча! ствующие в биосинтезе простагландинов [15].

  3. In-text reference with the coordinate start=7382
    Prefix
    Важная функция генов детоксикации ксенобиотиков — взаимодействие с эндо! генными факторами, для глутатионтрансфераз эндоген! ными субстратами являются билирубин и гормоны, уча! ствующие в биосинтезе простагландинов
    Exact
    [15]
    Suffix
    . Некоторые GST имеют сигнальные функции, ведущие к изменению экспрессии других генов. Так, GSTP1регулирует актив! ность Jun N!terminal kinase [21], а апоптоз!индуцирую! щая киназа ASK1 регулируется GSTM1[22].

  4. In-text reference with the coordinate start=18863
    Prefix
    Образующиеся при этом промежуточные электро! фильные метаболиты обладают токсическими свойст! вами. Для эффективной детоксикации ксенобиотиков необходимо равновесие между ферментами первой и второй фазы
    Exact
    [15]
    Suffix
    . Наиболее полно ферменты детокси! кации представлены в печени, но для большинства из них, показана экспрессия и в других органах, в том чис! ле, в легких и бронхах, например, глутатион!S трансфе! раз и цитохромов P!450 [18].

16
Сальникова Л. Е., Фомин Д. К., Елисова Т. В. и соавт.Изучение свя! зи цитогенетических и эпидемиологических показателей с геноти! пами у ликвидаторов последствий аварии на ЧАЭС. Радиационная биология. Радиоэкология 2008; 48 (3): 303—312.
Total in-text references: 2
  1. In-text reference with the coordinate start=6396
    Prefix
    участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит [12], периодонтит [13], острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких
    Exact
    [16]
    Suffix
    , хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST) [19, 20] — генов второй фазы деток! сикации ксенобиотиков.

  2. In-text reference with the coordinate start=11463
    Prefix
    Больные обеих групп получали комплексную интенсивную терапию, согласно патоге! неза основной нозологии, тяжести состояния. Выделение ДНК и генотипирование методом аллель!спе! цифической гибридизации по локусам GSTM1(del) GSTT1(del), GSTP1(A313G), MTHFR(C677T) описано ранее
    Exact
    [16]
    Suffix
    . Для выявления точковой мутации (A4889G) в гене CYP1A1проводили аллельспецифическую ПЦР (рис. 1) с ис! пользованием внешних (F и R) и внутренних (специфических, Fw и Rm) праймеров: F: 5'!gagctccactcacttgacacttct !3'; R: 5'!cagtgtctatgagtttcaggctgaatctt!3', Fw: 5'!gaagtgtatcggtgagacca !3'; Rm: 5'!ctcccagcgggcaac !3'.

17
Korytina G. F., Yanbaeva D. G., Babenkova L. I. et al. Genetic polymor! phisms in the cytochromes P!450 (1A1, 2E1), microsomal epoxide hydrolase and glutathione S!transferase M1, T1, and P1 genes, and their relationship with chronic bronchitis and relapsing pneumonia in children. J. Mol. Med. 2005; 83 (9): 700—710.
Total in-text references: 1
  1. In-text reference with the coordinate start=6455
    Prefix
    Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний
    Exact
    [17]
    Suffix
    , эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST) [19, 20] — генов второй фазы деток! сикации ксенобиотиков.

18
Cantlay A. M., Lamb D., Gillooly M. et al.Association between the CYP1A1gene polymorphism and susceptibility to emphysema and lung cancer. Clin. Mol. Pathol. 1995; 48 (4): 210—214.
Total in-text references: 3
  1. In-text reference with the coordinate start=6489
    Prefix
    Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких
    Exact
    [18]
    Suffix
    . Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST) [19, 20] — генов второй фазы деток! сикации ксенобиотиков.

  2. In-text reference with the coordinate start=19083
    Prefix
    Наиболее полно ферменты детокси! кации представлены в печени, но для большинства из них, показана экспрессия и в других органах, в том чис! ле, в легких и бронхах, например, глутатион!S трансфе! раз и цитохромов P!450
    Exact
    [18]
    Suffix
    . CYP1A1— индуцибель! ный фермент 1 фазы детоксикации — характеризуется внепеченочной экспрессией и, под воздействием мно! гих вредных факторов, в высоких концентрациях реги! стрируется в легких, включая клетки «быстрого реаги! рования» иммунной системы организма — альвеолярные макрофаги [27].

  3. In-text reference with the coordinate start=19844
    Prefix
    В многочисленных работах показана ассоциация данно! го полиморфизма с различной легочной патологией, в том числе воспалительными процессами, под воздейст! вием химических и механических факторов
    Exact
    [18, 27]
    Suffix
    . В исследованной когорте нельзя полностью исключить совокупного влияния токсичных соединений и геноти! па на развитие ВП (курение, воздействие горюче!сма! зочных материалов, выхлопные газы и др.

19
Gilliland F. D., Gauderman W. J., Vora H. et al.Effects of glutathione!S! transferase M1, T1, and P1 on childhood lung function growth. Am. J. Respir. Crit. Care Med. 2002; 165 (5): 710—716.
Total in-text references: 1
  1. In-text reference with the coordinate start=6629
    Prefix
    ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST)
    Exact
    [19, 20]
    Suffix
    — генов второй фазы деток! сикации ксенобиотиков. Из многочисленных глутатион S!трансфераз наиболее полиморфны гены GSTM1и GSTT1; полиморфизм их имеет делеционный характер и встречается в разных популяциях с частотой 50—70% и 20—40%, соответственно.

20
Imboden M., Downs S. H., Senn O. et al.Glutathione S!transferase geno! types modify lung function decline in the general population: SAPAL! DIA cohort study. Respiratory Res. 2007; 8: 2.
Total in-text references: 1
  1. In-text reference with the coordinate start=6629
    Prefix
    ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST)
    Exact
    [19, 20]
    Suffix
    — генов второй фазы деток! сикации ксенобиотиков. Из многочисленных глутатион S!трансфераз наиболее полиморфны гены GSTM1и GSTT1; полиморфизм их имеет делеционный характер и встречается в разных популяциях с частотой 50—70% и 20—40%, соответственно.

21
Holley S. L., Fryer A. A., Haycock J. W. et al.Differential effects of glu! tathione S!transferase pi (GSTP1) haplotypes on cell proliferation and apoptosis. Carcinogenesis 2007; 11: 2268—2273.
Total in-text references: 1
  1. In-text reference with the coordinate start=7540
    Prefix
    Важная функция генов детоксикации ксенобиотиков — взаимодействие с эндо! генными факторами, для глутатионтрансфераз эндоген! ными субстратами являются билирубин и гормоны, уча! ствующие в биосинтезе простагландинов [15]. Некоторые GST имеют сигнальные функции, ведущие к изменению экспрессии других генов. Так, GSTP1регулирует актив! ность Jun N!terminal kinase
    Exact
    [21]
    Suffix
    , а апоптоз!индуцирую! щая киназа ASK1 регулируется GSTM1[22]. Цель работы — изучить влияния полиморфизма генов первой и второй фазы детоксикации ксенобиоти! ков, соответственно, арил гидрокарбон гидролазы CYP1A1и глутатион!

22
Dorion S., Lambert H., Landry J.Activation of the 38 signaling pathway by heat shock involves the dissociation of glutathione S!transferase Mu from Ask1. J. Biol. Chemistry 2002; 277 (34): 30792—30797.
Total in-text references: 1
  1. In-text reference with the coordinate start=7600
    Prefix
    Некоторые GST имеют сигнальные функции, ведущие к изменению экспрессии других генов. Так, GSTP1регулирует актив! ность Jun N!terminal kinase [21], а апоптоз!индуцирую! щая киназа ASK1 регулируется GSTM1
    Exact
    [22]
    Suffix
    . Цель работы — изучить влияния полиморфизма генов первой и второй фазы детоксикации ксенобиоти! ков, соответственно, арил гидрокарбон гидролазы CYP1A1и глутатион!S!трансфераз GSTM1, GSTT1, GSTP1,и гена!триггера, ответственного за синтез и ме! тилирование ДНК — 5,10 метилен тетрагидрофолатре! дуктазы MTHFR, на возникновение и течение пневмо! нии различного генеза.

23
Ta b l a n O . C . , A n d e r s o n L . J . , B e s s e r R . e t a l . Recommendations of CDC and the Healthcare infection control practices advisory committee: guidelines for preventing health!care!associated pneumonia, 2003. Morb. Mortal Wkly. Rep. 2004; 53 (RR!3): 1—36.
Total in-text references: 1
  1. In-text reference with the coordinate start=10118
    Prefix
    больных с ВП определяли на основании размеров пневмонической инфиль! трации, выраженности интоксикации, степени нарушения функций дыхательной и сердечно!сосудистой систем (Приказ МЗ РФ No 300 от 9 октября 1998 г.) [1]. В соответствии с оп! ределениями зарубежных и российских авторов, нозокоми! альной мы считали пневмонию, развившуюся спустя 48 часов и более от момента госпитализации
    Exact
    [23, 24]
    Suffix
    . С помощью шка! лы Clinical Pulmonary Infection Score (CPIS) [25] оценивали тяжесть пневмонии. По общепринятым методикам выполняли обследование больных, которое включало оценку объективного состояния, дан! ных лабораторных и инструментальных методов исследования, R!графию органов грудной полости, мониторинг газового состава артериальной и смешанной венозной крови, кислотно!основн

24
Гельфанд Б. Р. , Белоцерковский Б. З. , Проценко Д. Н.Нозокомиаль! ная пневмония в хирургии. Методические рекомендации РАСХИ. М.: 2004. 5—15.
Total in-text references: 1
  1. In-text reference with the coordinate start=10118
    Prefix
    больных с ВП определяли на основании размеров пневмонической инфиль! трации, выраженности интоксикации, степени нарушения функций дыхательной и сердечно!сосудистой систем (Приказ МЗ РФ No 300 от 9 октября 1998 г.) [1]. В соответствии с оп! ределениями зарубежных и российских авторов, нозокоми! альной мы считали пневмонию, развившуюся спустя 48 часов и более от момента госпитализации
    Exact
    [23, 24]
    Suffix
    . С помощью шка! лы Clinical Pulmonary Infection Score (CPIS) [25] оценивали тяжесть пневмонии. По общепринятым методикам выполняли обследование больных, которое включало оценку объективного состояния, дан! ных лабораторных и инструментальных методов исследования, R!графию органов грудной полости, мониторинг газового состава артериальной и смешанной венозной крови, кислотно!основн

25
Сlinical pulmonary infection score; Pugin J., Auckenthaler R. et al. Diagnosis of ventilator!associated pneumonia by bacteriological analy! sis of bronchoscopic and non bronchoscopic «blind» bronchoalveolar lavage fiuid. Am. Rev. Respire Dis. 1991; 143: 1121—1129.
Total in-text references: 1
  1. In-text reference with the coordinate start=10191
    Prefix
    В соответствии с оп! ределениями зарубежных и российских авторов, нозокоми! альной мы считали пневмонию, развившуюся спустя 48 часов и более от момента госпитализации [23, 24]. С помощью шка! лы Clinical Pulmonary Infection Score (CPIS)
    Exact
    [25]
    Suffix
    оценивали тяжесть пневмонии. По общепринятым методикам выполняли обследование больных, которое включало оценку объективного состояния, дан! ных лабораторных и инструментальных методов исследования, R!графию органов грудной полости, мониторинг газового состава артериальной и смешанной венозной крови, кислотно!основного и электролитного баланса.

26
Masson L. F., Sharp L., Cotton S. C., Little J.Cytochrome P!450 1A1 gene poly! morphisms and risk of breast cancer. Am. J. Epidem. 2005; 161 (10): 901—915.
Total in-text references: 1
  1. In-text reference with the coordinate start=14353
    Prefix
    фермента: 0/0.+/+—0,38, делеция (0/0)Наличие фермента: +/0—0,42, +/0 либо +/+0/0—0,20 GSTP1A313Grs 1695Пониженная активностьA/A—0,47, фермента для генотипа G/G, A/G—0,40, Ile105ValG/G—0,13 CYP1A1A4889Grs 1048943Повышенная активностьВ большинстве фермента для генотипа A/G,популяций белой G/G, Ile462Valрасы частота аллелей: A/A!0,92!0,96, A/G!0,04!0,08, G/G!0,00 (обзор популяционных данных)
    Exact
    [26]
    Suffix
    MTHFRC677Trs 1801133Пониженная активностьС/С!0,49, и повышенная термолабильностьC/T!0,45, фермента для генотипа T/T, T/T!0,06 Ala222Val Примечание. * — Online Mendelian Inheritance in Man. Таблица 2 Частоты однолокусных генотипов для исследованных групп больных (%) ЛокусыГенотипыКонтрольГруппа IГруппа II (n=95) (n=160)(n=99)подгруппа IIA (n=57) подгруппа IIB (n=38) CYP1A1A/A94,687,290,783,3 A/

27
Thum T., Erpenbeck V. J., Moeller J. et al.Expression of xenobiotic metabo! lizing enzymes in different lung compartments of smokers and nonsmok! ers. Environmental Health Perspectives 2006; 114 (11): 1655—1661.
Total in-text references: 2
  1. In-text reference with the coordinate start=19369
    Prefix
    CYP1A1— индуцибель! ный фермент 1 фазы детоксикации — характеризуется внепеченочной экспрессией и, под воздействием мно! гих вредных факторов, в высоких концентрациях реги! стрируется в легких, включая клетки «быстрого реаги! рования» иммунной системы организма — альвеолярные макрофаги
    Exact
    [27]
    Suffix
    . Минорный вариант CYP1A14889G (462Val) характеризуется увеличенной каталитической активностью этого гена и, соответст! венно, высокореактивные продукты его метаболизма в значительно большем, по сравнению с ферментом ди! кого типа, количестве присутствуют в организме.

  2. In-text reference with the coordinate start=19844
    Prefix
    В многочисленных работах показана ассоциация данно! го полиморфизма с различной легочной патологией, в том числе воспалительными процессами, под воздейст! вием химических и механических факторов
    Exact
    [18, 27]
    Suffix
    . В исследованной когорте нельзя полностью исключить совокупного влияния токсичных соединений и геноти! па на развитие ВП (курение, воздействие горюче!сма! зочных материалов, выхлопные газы и др.

28
Ke S., Rabson A. B., Germino J. F. et al.Mechanism of suppression of cytochrome P!450 1A1 expression by tumor necrosis factor!alpha and lipopolysaccharide. J. Biol Chem. 2001; 276 (43): 39638—39644.
Total in-text references: 1
  1. In-text reference with the coordinate start=21027
    Prefix
    Последние могут непосредственно стимулировать воспалительные клетки и амплифицировать воспалительные и окисли! тельные реакции. Кроме того, эндотоксины (бактери! альные липополисахариды), гипоксия, медиаторы вос! паления вызывают уменьшение экспрессии CYP1A1
    Exact
    [28, 29]
    Suffix
    . Нарушение баланса в системе детоксикации в условиях развивающегося оксидативного стресса мо! жет приводить к усугублению процесса, более выра! женного у носителей минорного варианта CYP1A1.

29
Zhang N., Walker M. K.Crosstalk between the aryl hydrocarbon recep! tor and hypoxia on the constitutive expression of cytochrome P4501A1 mRNA. Cardiovasc. Toxicol. 2007; 7 (4): 282—290.
Total in-text references: 1
  1. In-text reference with the coordinate start=21027
    Prefix
    Последние могут непосредственно стимулировать воспалительные клетки и амплифицировать воспалительные и окисли! тельные реакции. Кроме того, эндотоксины (бактери! альные липополисахариды), гипоксия, медиаторы вос! паления вызывают уменьшение экспрессии CYP1A1
    Exact
    [28, 29]
    Suffix
    . Нарушение баланса в системе детоксикации в условиях развивающегося оксидативного стресса мо! жет приводить к усугублению процесса, более выра! женного у носителей минорного варианта CYP1A1.

30
Habdous M., Herbeth B., Haddy N. et al.Smoking, genetic polymorphisms of glutathione S!transferases and biological indices of inflammation and cellular adhesion in the STANISLAS study. EXCLI J. 2004; 3: 58—67.
Total in-text references: 4
  1. In-text reference with the coordinate start=23270
    Prefix
    В ре! зультате воспалительных и оксидативных процессов образуется большое количество реактивных метаболи! тов — субстратов для GSTM1, влияющего на индивиду! альную чувствительность организма к эндогенным ме! таболитам оксидативного стресса
    Exact
    [30]
    Suffix
    . Возможно, аллергизация организма при генотипе GSTM10/0 [31] вносит существенный вклад в развитие осложненной пневмонии. Среди больных I группы встречаемость GSTM10/0 составила 37,4%, осложненное течение ВП диагностировано в 21,2%, среди умерших в данной группе — в 3,0%.

  2. In-text reference with the coordinate start=23990
    Prefix
    GSTT1участвует в детоксикации небольших молекул, например, дихлорметана, оксида этилена и др., по отношению к ряду соединений GSTT1 проявляет активность как фермент 1 фазы детоксика! ции, вызывая образование промежуточных цито! и ге! нотоксичных метаболитов
    Exact
    [30]
    Suffix
    . В многочисленных исследованиях в разных лабо! раториях показана корреляция мажорного варианта GSTT1+ с различными заболеваниями сердечно!сосу! дистой системы и другими патологиями, ассоциирован! ными с курением и неблагоприятной экологией [30, 32, 33].

  3. In-text reference with the coordinate start=24225
    Prefix
    В многочисленных исследованиях в разных лабо! раториях показана корреляция мажорного варианта GSTT1+ с различными заболеваниями сердечно!сосу! дистой системы и другими патологиями, ассоциирован! ными с курением и неблагоприятной экологией
    Exact
    [30, 32, 33]
    Suffix
    . Подавляющее число больных исследованных групп (80,4%) являются носителями функционального алле! ля GSTT1(вариант + /+ или +/null). В данной работе не было выделено отдельных групп в зависимости от нозологической формы ослож! нений, однако, на сегодняшний день известна ассоциа! ция генотипа GSTT1+ с сердечно!сосудистыми заболе! ваниями и увеличенным риском рака печени

  4. In-text reference with the coordinate start=24685
    Prefix
    В данной работе не было выделено отдельных групп в зависимости от нозологической формы ослож! нений, однако, на сегодняшний день известна ассоциа! ция генотипа GSTT1+ с сердечно!сосудистыми заболе! ваниями и увеличенным риском рака печени и почек при контакте с галоидированными органическими рас! творителями
    Exact
    [30]
    Suffix
    . Печень и почки — это основные орга! ны, в которых экспрессируется GSTT1. Экстрапульмо! нальные осложнения в виде миокардита и нефропатии среди больных с ВП составили 33,3 и 8,1%, а в группе с НП 65,8 и 34,2%, соответственно.

31
Wa n a n d J . , D i a z VS a n c h e z D .Phase II enzymes induction blocks the enhanced Ig production in B cells by diesel exhaust particles. J. Immunol. 2006; 177: 3477—3483.
Total in-text references: 1
  1. In-text reference with the coordinate start=23335
    Prefix
    В ре! зультате воспалительных и оксидативных процессов образуется большое количество реактивных метаболи! тов — субстратов для GSTM1, влияющего на индивиду! альную чувствительность организма к эндогенным ме! таболитам оксидативного стресса [30]. Возможно, аллергизация организма при генотипе GSTM10/0
    Exact
    [31]
    Suffix
    вносит существенный вклад в развитие осложненной пневмонии. Среди больных I группы встречаемость GSTM10/0 составила 37,4%, осложненное течение ВП диагностировано в 21,2%, среди умерших в данной группе — в 3,0%.

32
Marinho C., Alho I., Arduino D. et al.GST M1/T1 and MTHFR poly! morphisms as risk factors for hypertension. Biochem. Biophys. Res. Commun. 2007; 353 (2): 344—350.
Total in-text references: 1
  1. In-text reference with the coordinate start=24225
    Prefix
    В многочисленных исследованиях в разных лабо! раториях показана корреляция мажорного варианта GSTT1+ с различными заболеваниями сердечно!сосу! дистой системы и другими патологиями, ассоциирован! ными с курением и неблагоприятной экологией
    Exact
    [30, 32, 33]
    Suffix
    . Подавляющее число больных исследованных групп (80,4%) являются носителями функционального алле! ля GSTT1(вариант + /+ или +/null). В данной работе не было выделено отдельных групп в зависимости от нозологической формы ослож! нений, однако, на сегодняшний день известна ассоциа! ция генотипа GSTT1+ с сердечно!сосудистыми заболе! ваниями и увеличенным риском рака печени

33
Girisha K. M., Gilmour A., Mastana S. et al. T1 and M1 polymorphism in glutathione S!transferase gene and coronary artery disease in North Indian population. Indian J. Med. Sci. 2004; 58 (12): 520—526. Поступила 23.09.08 План научноWорганизационных мероприятий
Total in-text references: 1
  1. In-text reference with the coordinate start=24225
    Prefix
    В многочисленных исследованиях в разных лабо! раториях показана корреляция мажорного варианта GSTT1+ с различными заболеваниями сердечно!сосу! дистой системы и другими патологиями, ассоциирован! ными с курением и неблагоприятной экологией
    Exact
    [30, 32, 33]
    Suffix
    . Подавляющее число больных исследованных групп (80,4%) являются носителями функционального алле! ля GSTT1(вариант + /+ или +/null). В данной работе не было выделено отдельных групп в зависимости от нозологической формы ослож! нений, однако, на сегодняшний день известна ассоциа! ция генотипа GSTT1+ с сердечно!сосудистыми заболе! ваниями и увеличенным риском рака печени