The 38 reference contexts in paper L. Salnikova Ye., T. Smelaya V., V. Moroz V., A. Golubev M., N. Ponasenkov Kh., R. Khomenko V., I. Kharlamova V., N. Lapteva Sh., G. Kuznetsova I., G. Poroshenko G., A. Rubanovich V., Л. Сальникова Е., Т. Смелая В., В. Мороз В, А. Голубев М, Н. Понасенков Х., Р. Хоменко В., И. Харламова Е., Н. Лаптева Ш., Г. Кузнецова И., Г. Порошенко Г., А. Рубанович В. (2008) “Гены детоксикации ксенобиотиков и их роль в развитии пневмонии // Xenobiotic Detoxification Genes and Their Role in the Development of Pneumonia” / spz:neicon:reanimatology:634

  1. Start
    (2B), NP does not develop statistically significantly in 61.1% of cases with the GSTM1 + GSTT1+ genotype versus 38.8% in the controls (p=0.022) or versus 37.5% in subgroup 2A (p=0.045; OR=2.6). Key words:acute communityWacquired pneumonia, nosocomial pneumonia, gene polymorphism. Пневмония по!прежнему занимает 1!е место в структуре причин смерти среди инфекционных болез! ней
    . В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией [2, 3], 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5% [1, 4]. В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии [1].
    (check this in PDF content)

  2. Start
    Key words:acute communityWacquired pneumonia, nosocomial pneumonia, gene polymorphism. Пневмония по!прежнему занимает 1!е место в структуре причин смерти среди инфекционных болез! ней [1]. В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией
    [2, 3]
    , 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5% [1, 4]. В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии [1].
    (check this in PDF content)

  3. Start
    Пневмония по!прежнему занимает 1!е место в структуре причин смерти среди инфекционных болез! ней [1]. В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией [2, 3], 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5%
    [1, 4]
    . В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии [1]. В Рос! сии заболеваемость колеблется в пределах 10—14 человек, а в других развитых странах мира — от 3,6 до 16 человек на 1000 человек в год.
    (check this in PDF content)

  4. Start
    В США ежегодно регистрируют от 2 до 6 млн случаев заболевания пневмонией [2, 3], 30—40% из них нуждаются в госпитализации, летальность среди них составляет 1—5% [1, 4]. В последние десятилетия в Рос! сии, как и во всем мире, отмечена тенденция к росту за! болеваемости и летальности от пневмонии
    . В Рос! сии заболеваемость колеблется в пределах 10—14 человек, а в других развитых странах мира — от 3,6 до 16 человек на 1000 человек в год. В крупных городах Рос! сии с 1990 г. заболеваемость пневмонией возросла в 4 раза, а летальность при ней — в 3 раза [1].
    (check this in PDF content)

  5. Start
    В Рос! сии заболеваемость колеблется в пределах 10—14 человек, а в других развитых странах мира — от 3,6 до 16 человек на 1000 человек в год. В крупных городах Рос! сии с 1990 г. заболеваемость пневмонией возросла в 4 раза, а летальность при ней — в 3 раза
    . Высокие по! казатели заболеваемости пневмонией регистрируют среди воинских контингентов. В Вооруженных Силах РФ средняя заболеваемость пневмонией у военнослу! жащих, проходивших службу по призыву, за 25!летний период составила 12,5% [5].
    (check this in PDF content)

  6. Start
    Высокие по! казатели заболеваемости пневмонией регистрируют среди воинских контингентов. В Вооруженных Силах РФ средняя заболеваемость пневмонией у военнослу! жащих, проходивших службу по призыву, за 25!летний период составила 12,5%
    . В 2002 г. уровень заболева! емости пневмонией возрос, по сравнению с таковыми в 2001 г., на 2,1% — с 43,8 до 44,7‰ [6]. Традиционно подъем заболеваемости острыми респираторными ви! русными инфекциями, бронхитами и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, э
    (check this in PDF content)

  7. Start
    В Вооруженных Силах РФ средняя заболеваемость пневмонией у военнослу! жащих, проходивших службу по призыву, за 25!летний период составила 12,5% [5]. В 2002 г. уровень заболева! емости пневмонией возрос, по сравнению с таковыми в 2001 г., на 2,1% — с 43,8 до 44,7‰
    . Традиционно подъем заболеваемости острыми респираторными ви! русными инфекциями, бронхитами и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, эколо! гических и других факторов) [7, 8].
    (check this in PDF content)

  8. Start
    Традиционно подъем заболеваемости острыми респираторными ви! русными инфекциями, бронхитами и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, эколо! гических и других факторов)
    [7, 8]
    . Ежегодно в отдель! ных учебных центрах некоторых военных округов у молодого пополнения регистрируют эпидемические вспышки пневмонии с ростом заболеваемости до 250‰ и выше [6, 9]. Немаловажное значение придается госпитальной (нозокомиальной) пневмонии (НП), составляющей 10—15% от всех госпитальных инфекций.
    (check this in PDF content)

  9. Start
    и пневмонией свя! зан с влиянием сезонных и климатических факторов, периодов и особенностей воинской службы (адаптация новобранцев, воздействие профессиональных, эколо! гических и других факторов) [7, 8]. Ежегодно в отдель! ных учебных центрах некоторых военных округов у молодого пополнения регистрируют эпидемические вспышки пневмонии с ростом заболеваемости до 250‰ и выше
    [6, 9]
    . Немаловажное значение придается госпитальной (нозокомиальной) пневмонии (НП), составляющей 10—15% от всех госпитальных инфекций. Летальность от НП составляет от 30—60 до 80% [10]. Не вызывает сомнений тот факт, что помимо свойств возбудителя заболевания, на развитие и исход любого инфекционного процесса и пневмонии, в том числе, влияет и сопротивляемость организма,
    (check this in PDF content)

  10. Start
    Ежегодно в отдель! ных учебных центрах некоторых военных округов у молодого пополнения регистрируют эпидемические вспышки пневмонии с ростом заболеваемости до 250‰ и выше [6, 9]. Немаловажное значение придается госпитальной (нозокомиальной) пневмонии (НП), составляющей 10—15% от всех госпитальных инфекций. Летальность от НП составляет от 30—60 до 80%
    . Не вызывает сомнений тот факт, что помимо свойств возбудителя заболевания, на развитие и исход любого инфекционного процесса и пневмонии, в том числе, влияет и сопротивляемость организма, определя! емая его генетическим статусом.
    (check this in PDF content)

  11. Start
    Течение многих острых заболеваний, возникнове! ние осложнений зависят от генов!кандидатов, наиболее изученными из которых являются гены цитокинов и ге! ны детоксикации ксенобиотиков. В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция
    , острый панкреатит [12], периодонтит [13], острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18].
    (check this in PDF content)

  12. Start
    Течение многих острых заболеваний, возникнове! ние осложнений зависят от генов!кандидатов, наиболее изученными из которых являются гены цитокинов и ге! ны детоксикации ксенобиотиков. В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит
    , периодонтит [13], острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18].
    (check this in PDF content)

  13. Start
    В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит [12], периодонтит
    , острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18].
    (check this in PDF content)

  14. Start
    В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит [12], периодонтит [13], острая патология кишечника
    . Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18].
    (check this in PDF content)

  15. Start
    В литературе показано участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит [12], периодонтит [13], острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы
    , хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST) [19, 20] — генов второй фазы деток! сикации ксенобиотиков.
    (check this in PDF content)

  16. Start
    участие генов детоксикации ксенобиотиков в развитии не только хронических, но и острых заболеваний: острая респираторная инфекция [11], острый панкреатит [12], периодонтит [13], острая патология кишечника [14]. Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких
    , хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST) [19, 20] — генов второй фазы деток! сикации ксенобиотиков.
    (check this in PDF content)

  17. Start
    Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний
    , эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST) [19, 20] — генов второй фазы деток! сикации ксенобиотиков.
    (check this in PDF content)

  18. Start
    Гены детоксикации ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких
    . Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST) [19, 20] — генов второй фазы деток! сикации ксенобиотиков.
    (check this in PDF content)

  19. Start
    ксенобиотиков являются фак! торами риска хронических заболеваний дыхательной си! стемы: астмы [15], хронической обструктивной болезни легких [16], хронических бронхитов и рецидивирующих пневмоний [17], эмфиземы и рака легких [18]. Развитие легочной функции у детей и скорость ее ухудшения с воз! растом также зависит от генотипа по локусам глутатион S!трансфераз (GST)
    [19, 20]
    — генов второй фазы деток! сикации ксенобиотиков. Из многочисленных глутатион S!трансфераз наиболее полиморфны гены GSTM1и GSTT1; полиморфизм их имеет делеционный характер и встречается в разных популяциях с частотой 50—70% и 20—40%, соответственно.
    (check this in PDF content)

  20. Start
    Глутатионтрансферазы катали! зируют реакцию глутамата с различными органическими радикалами и играют ключевую роль в обеспечении рези! стентности клеток к перекисному окислению жиров, сво! бодным радикалам, алкилированию белков и в предот! вращении поломок ДНК
    . Важная функция генов детоксикации ксенобиотиков — взаимодействие с эндо! генными факторами, для глутатионтрансфераз эндоген! ными субстратами являются билирубин и гормоны, уча! ствующие в биосинтезе простагландинов [15].
    (check this in PDF content)

  21. Start
    Важная функция генов детоксикации ксенобиотиков — взаимодействие с эндо! генными факторами, для глутатионтрансфераз эндоген! ными субстратами являются билирубин и гормоны, уча! ствующие в биосинтезе простагландинов
    . Некоторые GST имеют сигнальные функции, ведущие к изменению экспрессии других генов. Так, GSTP1регулирует актив! ность Jun N!terminal kinase [21], а апоптоз!индуцирую! щая киназа ASK1 регулируется GSTM1[22].
    (check this in PDF content)

  22. Start
    Важная функция генов детоксикации ксенобиотиков — взаимодействие с эндо! генными факторами, для глутатионтрансфераз эндоген! ными субстратами являются билирубин и гормоны, уча! ствующие в биосинтезе простагландинов [15]. Некоторые GST имеют сигнальные функции, ведущие к изменению экспрессии других генов. Так, GSTP1регулирует актив! ность Jun N!terminal kinase
    , а апоптоз!индуцирую! щая киназа ASK1 регулируется GSTM1[22]. Цель работы — изучить влияния полиморфизма генов первой и второй фазы детоксикации ксенобиоти! ков, соответственно, арил гидрокарбон гидролазы CYP1A1и глутатион!
    (check this in PDF content)

  23. Start
    Некоторые GST имеют сигнальные функции, ведущие к изменению экспрессии других генов. Так, GSTP1регулирует актив! ность Jun N!terminal kinase [21], а апоптоз!индуцирую! щая киназа ASK1 регулируется GSTM1
    . Цель работы — изучить влияния полиморфизма генов первой и второй фазы детоксикации ксенобиоти! ков, соответственно, арил гидрокарбон гидролазы CYP1A1и глутатион!S!трансфераз GSTM1, GSTT1, GSTP1,и гена!триггера, ответственного за синтез и ме! тилирование ДНК — 5,10 метилен тетрагидрофолатре! дуктазы MTHFR, на возникновение и течение пневмо! нии различного генеза.
    (check this in PDF content)

  24. Start
    Степень тяжести больных с ВП определяли на основании размеров пневмонической инфиль! трации, выраженности интоксикации, степени нарушения функций дыхательной и сердечно!сосудистой систем (Приказ МЗ РФ No 300 от 9 октября 1998 г.)
    . В соответствии с оп! ределениями зарубежных и российских авторов, нозокоми! альной мы считали пневмонию, развившуюся спустя 48 часов и более от момента госпитализации [23, 24]. С помощью шка! лы Clinical Pulmonary Infection Score (CPIS) [25] оценивали тяжесть пневмонии.
    (check this in PDF content)

  25. Start
    больных с ВП определяли на основании размеров пневмонической инфиль! трации, выраженности интоксикации, степени нарушения функций дыхательной и сердечно!сосудистой систем (Приказ МЗ РФ No 300 от 9 октября 1998 г.) [1]. В соответствии с оп! ределениями зарубежных и российских авторов, нозокоми! альной мы считали пневмонию, развившуюся спустя 48 часов и более от момента госпитализации
    [23, 24]
    . С помощью шка! лы Clinical Pulmonary Infection Score (CPIS) [25] оценивали тяжесть пневмонии. По общепринятым методикам выполняли обследование больных, которое включало оценку объективного состояния, дан! ных лабораторных и инструментальных методов исследования, R!графию органов грудной полости, мониторинг газового состава артериальной и смешанной венозной крови, кислотно!основн
    (check this in PDF content)

  26. Start
    В соответствии с оп! ределениями зарубежных и российских авторов, нозокоми! альной мы считали пневмонию, развившуюся спустя 48 часов и более от момента госпитализации [23, 24]. С помощью шка! лы Clinical Pulmonary Infection Score (CPIS)
    оценивали тяжесть пневмонии. По общепринятым методикам выполняли обследование больных, которое включало оценку объективного состояния, дан! ных лабораторных и инструментальных методов исследования, R!графию органов грудной полости, мониторинг газового состава артериальной и смешанной венозной крови, кислотно!основного и электролитного баланса.
    (check this in PDF content)

  27. Start
    Больные обеих групп получали комплексную интенсивную терапию, согласно патоге! неза основной нозологии, тяжести состояния. Выделение ДНК и генотипирование методом аллель!спе! цифической гибридизации по локусам GSTM1(del) GSTT1(del), GSTP1(A313G), MTHFR(C677T) описано ранее
    . Для выявления точковой мутации (A4889G) в гене CYP1A1проводили аллельспецифическую ПЦР (рис. 1) с ис! пользованием внешних (F и R) и внутренних (специфических, Fw и Rm) праймеров: F: 5'!gagctccactcacttgacacttct !3'; R: 5'!cagtgtctatgagtttcaggctgaatctt!3', Fw: 5'!gaagtgtatcggtgagacca !3'; Rm: 5'!ctcccagcgggcaac !3'.
    (check this in PDF content)

  28. Start
    фермента: 0/0.+/+—0,38, делеция (0/0)Наличие фермента: +/0—0,42, +/0 либо +/+0/0—0,20 GSTP1A313Grs 1695Пониженная активностьA/A—0,47, фермента для генотипа G/G, A/G—0,40, Ile105ValG/G—0,13 CYP1A1A4889Grs 1048943Повышенная активностьВ большинстве фермента для генотипа A/G,популяций белой G/G, Ile462Valрасы частота аллелей: A/A!0,92!0,96, A/G!0,04!0,08, G/G!0,00 (обзор популяционных данных)
    MTHFRC677Trs 1801133Пониженная активностьС/С!0,49, и повышенная термолабильностьC/T!0,45, фермента для генотипа T/T, T/T!0,06 Ala222Val Примечание. * — Online Mendelian Inheritance in Man. Таблица 2 Частоты однолокусных генотипов для исследованных групп больных (%) ЛокусыГенотипыКонтрольГруппа IГруппа II (n=95) (n=160)(n=99)подгруппа IIA (n=57) подгруппа IIB (n=38) CYP1A1A/A94,687,290,783,3 A/
    (check this in PDF content)

  29. Start
    Образующиеся при этом промежуточные электро! фильные метаболиты обладают токсическими свойст! вами. Для эффективной детоксикации ксенобиотиков необходимо равновесие между ферментами первой и второй фазы
    . Наиболее полно ферменты детокси! кации представлены в печени, но для большинства из них, показана экспрессия и в других органах, в том чис! ле, в легких и бронхах, например, глутатион!S трансфе! раз и цитохромов P!450 [18].
    (check this in PDF content)

  30. Start
    Наиболее полно ферменты детокси! кации представлены в печени, но для большинства из них, показана экспрессия и в других органах, в том чис! ле, в легких и бронхах, например, глутатион!S трансфе! раз и цитохромов P!450
    . CYP1A1— индуцибель! ный фермент 1 фазы детоксикации — характеризуется внепеченочной экспрессией и, под воздействием мно! гих вредных факторов, в высоких концентрациях реги! стрируется в легких, включая клетки «быстрого реаги! рования» иммунной системы организма — альвеолярные макрофаги [27].
    (check this in PDF content)

  31. Start
    CYP1A1— индуцибель! ный фермент 1 фазы детоксикации — характеризуется внепеченочной экспрессией и, под воздействием мно! гих вредных факторов, в высоких концентрациях реги! стрируется в легких, включая клетки «быстрого реаги! рования» иммунной системы организма — альвеолярные макрофаги
    . Минорный вариант CYP1A14889G (462Val) характеризуется увеличенной каталитической активностью этого гена и, соответст! венно, высокореактивные продукты его метаболизма в значительно большем, по сравнению с ферментом ди! кого типа, количестве присутствуют в организме.
    (check this in PDF content)

  32. Start
    В многочисленных работах показана ассоциация данно! го полиморфизма с различной легочной патологией, в том числе воспалительными процессами, под воздейст! вием химических и механических факторов
    [18, 27]
    . В исследованной когорте нельзя полностью исключить совокупного влияния токсичных соединений и геноти! па на развитие ВП (курение, воздействие горюче!сма! зочных материалов, выхлопные газы и др.
    (check this in PDF content)

  33. Start
    Последние могут непосредственно стимулировать воспалительные клетки и амплифицировать воспалительные и окисли! тельные реакции. Кроме того, эндотоксины (бактери! альные липополисахариды), гипоксия, медиаторы вос! паления вызывают уменьшение экспрессии CYP1A1
    [28, 29]
    . Нарушение баланса в системе детоксикации в условиях развивающегося оксидативного стресса мо! жет приводить к усугублению процесса, более выра! женного у носителей минорного варианта CYP1A1.
    (check this in PDF content)

  34. Start
    В ре! зультате воспалительных и оксидативных процессов образуется большое количество реактивных метаболи! тов — субстратов для GSTM1, влияющего на индивиду! альную чувствительность организма к эндогенным ме! таболитам оксидативного стресса
    . Возможно, аллергизация организма при генотипе GSTM10/0 [31] вносит существенный вклад в развитие осложненной пневмонии. Среди больных I группы встречаемость GSTM10/0 составила 37,4%, осложненное течение ВП диагностировано в 21,2%, среди умерших в данной группе — в 3,0%.
    (check this in PDF content)

  35. Start
    В ре! зультате воспалительных и оксидативных процессов образуется большое количество реактивных метаболи! тов — субстратов для GSTM1, влияющего на индивиду! альную чувствительность организма к эндогенным ме! таболитам оксидативного стресса [30]. Возможно, аллергизация организма при генотипе GSTM10/0
    вносит существенный вклад в развитие осложненной пневмонии. Среди больных I группы встречаемость GSTM10/0 составила 37,4%, осложненное течение ВП диагностировано в 21,2%, среди умерших в данной группе — в 3,0%.
    (check this in PDF content)

  36. Start
    GSTT1участвует в детоксикации небольших молекул, например, дихлорметана, оксида этилена и др., по отношению к ряду соединений GSTT1 проявляет активность как фермент 1 фазы детоксика! ции, вызывая образование промежуточных цито! и ге! нотоксичных метаболитов
    . В многочисленных исследованиях в разных лабо! раториях показана корреляция мажорного варианта GSTT1+ с различными заболеваниями сердечно!сосу! дистой системы и другими патологиями, ассоциирован! ными с курением и неблагоприятной экологией [30, 32, 33].
    (check this in PDF content)

  37. Start
    В многочисленных исследованиях в разных лабо! раториях показана корреляция мажорного варианта GSTT1+ с различными заболеваниями сердечно!сосу! дистой системы и другими патологиями, ассоциирован! ными с курением и неблагоприятной экологией
    [30, 32, 33]
    . Подавляющее число больных исследованных групп (80,4%) являются носителями функционального алле! ля GSTT1(вариант + /+ или +/null). В данной работе не было выделено отдельных групп в зависимости от нозологической формы ослож! нений, однако, на сегодняшний день известна ассоциа! ция генотипа GSTT1+ с сердечно!сосудистыми заболе! ваниями и увеличенным риском рака печени
    (check this in PDF content)

  38. Start
    В данной работе не было выделено отдельных групп в зависимости от нозологической формы ослож! нений, однако, на сегодняшний день известна ассоциа! ция генотипа GSTT1+ с сердечно!сосудистыми заболе! ваниями и увеличенным риском рака печени и почек при контакте с галоидированными органическими рас! творителями
    . Печень и почки — это основные орга! ны, в которых экспрессируется GSTT1. Экстрапульмо! нальные осложнения в виде миокардита и нефропатии среди больных с ВП составили 33,3 и 8,1%, а в группе с НП 65,8 и 34,2%, соответственно.
    (check this in PDF content)