The 29 reference contexts in paper Anna Ulitina S., Lubov’ Novikova N., Yuliya Il'kovich M., Olga Baranova P., Tat'yana Makarova V., Evgeniya Volkova V., Sofiya Pchelina N., Mikhail Il'kovich M., Mikhail Dubina V., А. Улитина С., Л. Новикова Н., Ю. Илькович М., О. Баранова П., Т. Макарова В., Е. Волкова В., С. Пчелина Н., М. Илькович М., М. Дубина В. (2017) “Влияние вариантов генов AGT, TGFB1, ESR1 и VDR на развитие и течение идиопатических интерстициальных пневмоний и саркоидоза органов дыхания // Influence of AGT, TGFB1, ESR1, and VDR gene variants on development and course of idiopathic interstitial pneumonias and pulmonary sarcoidosis” / spz:neicon:pulmonology:y:2017:i:3:p:346-356

  1. Start
    8358
    Prefix
    DOI: 10.18093/0869-0189-2017-27-3-346-356 Оригинальные исследования Интерстициальные заболевания легких (ИЗЛ) – это гетерогенная группа заболеваний и патологических состояний, характеризующихся различной степенью паренхиматозного неинфекционного воспаления (по типу альвеолита и / или гранулематоза) с последующим развитием фиброза
    Exact
    [1]
    Suffix
    . Значительная часть ИЗЛ относится к редким болезням (распространенность < 10 на 100 тыс. населения), однако они вносят существенный вклад в структуру смертности: по данным международного исследования Global Burden of Disease Study, в 2013 г. среди всех заболеваний по числу непрожитых лет жизни ИЗЛ отведено 40-е место с увеличением этого показателя на 86 % по сравнению
    (check this in PDF content)

  2. Start
    8777
    Prefix
    ИЗЛ относится к редким болезням (распространенность < 10 на 100 тыс. населения), однако они вносят существенный вклад в структуру смертности: по данным международного исследования Global Burden of Disease Study, в 2013 г. среди всех заболеваний по числу непрожитых лет жизни ИЗЛ отведено 40-е место с увеличением этого показателя на 86 % по сравнению с 1990-м годом
    Exact
    [2]
    Suffix
    , что, несомненно, обусловлено тяжестью течения ИЗЛ и отсутствием эффективных методов лечения при большинстве из них. Следует отметить, что оказание специализированной медицинской помощи больным ИЗЛ в Российской Федерации все еще остается неудовлетворительным.
    (check this in PDF content)

  3. Start
    15700
    Prefix
    Influence of AGT, TGFB1, ESR1, andVDRgene variants on development and course of idiopathic interstitial pneumonias and pulmonary sarcoidosis.Russian Pulmonology. 2017; 27 (3): 346– 356 (in Russian). DOI: 10.18093/0869-0189-2017-27-3-346-356 ствующее прогрессированию болезни) установлен у 80 % больных
    Exact
    [1]
    Suffix
    , что свидетельствует о недостаточной осведомленности врачей о данной патологии, отсутствии клинико-рентгенологических и в ряде случаев – о морфологических патогномоничных симптомах, низкой информативности рутинных лабораторных тестов.
    (check this in PDF content)

  4. Start
    16888
    Prefix
    В итоге в легких происходит ремоделирование внеклеточного матрикса, включая деструкцию базальной мембраны, ангиогенез и фиброз. Прогноз при ИИП неблагоприятен: медиана (Me) выживаемости при идиопатическом легочном фиброзе составляет 2–3 года с момента установления диагноза
    Exact
    [2]
    Suffix
    . Саркоидоз – полисистемное заболевание неизвестной этиологии, характеризующееся развитием иммунного воспаления с формированием эпителиоидно-клеточных гранулем без некроза с исходом в рассасывание или фиброз.
    (check this in PDF content)

  5. Start
    17553
    Prefix
    Отмечены определенные особенности течения заболевания у лиц разных рас: легкое, нередко бессимптомное течение, или острое, с благоприятным прогнозом – у представителей европеоидной расы и более тяжелое течение в сочетании с внелегочными поражениями (кожи, глаз, сердца и т. п.) – у лиц афроамериканской и японской популяций
    Exact
    [3, 4]
    Suffix
    . При саркоидозе органы дыхания вовлекаются в патологический процесс в 95 % случаев. С большой долей вероятности можно предположить наличие многофакторности в возникновении Улитина А.С. и др.
    (check this in PDF content)

  6. Start
    20135
    Prefix
    Определенное мнение о значимости генетических факторов в развитии ИИП и СОД существует, однако до настоящего времени неизвестно, какие именно генетические варианты вносят в патогенез этих заболеваний наибольший вклад
    Exact
    [5, 6]
    Suffix
    . Гены-кандидаты выбирались на основе литературных данных о функциях их белковых продуктов и распространенности и значимости их однонуклеотидного полиморфизма (ОНП). При этом внимание обращалось в первую очередь на белки широкого спектра действия, участвующие в процессах фиброзирования и иммунного ответа.
    (check this in PDF content)

  7. Start
    23332
    Prefix
    Таблица 3 Структура и температуры отжига праймеров для полимеразной цепной реакции Table 3 The structure and the temperature of annealing of primers for polymerase chain reaction ГенОНППрямой (F) и обратный (R) праймерыTемпература, °СИсточник AGTrs5051F: 5'3AGCCCACAGCTCAGTTACAT33'60,0
    Exact
    [7]
    Suffix
    , с изм. R: 5'3TGGCCAAGTGATGTAACCCTC33' TGFB1rs1800469F: 5'3CACATGGGAGGTGCTCAGTA33'60,0[8], с изм. R: 5'3GTCAGGCTGGGAAACAAGGTA33' rs1800470F: 5'3CCTCCCCACCACACCAG33'58,5[8] rs1800471R: 5'3CCGCAGCTTGGACAGG33' ESR1rs2234693F: 5’3GATATCCAGGGTTATGTGGCA33’60,0[9] rs9340799R: 5’3AGGTGTTGCCTATTATATTAACCTTGA33’ VDRrs731236F: 5'3CAGAGCATGGACAGGGAGCAA33'63,0[10] R: 5'3GCAACTCCTCATGGCTGAGGTCTC33' Примечание:
    (check this in PDF content)

  8. Start
    23420
    Prefix
    Таблица 3 Структура и температуры отжига праймеров для полимеразной цепной реакции Table 3 The structure and the temperature of annealing of primers for polymerase chain reaction ГенОНППрямой (F) и обратный (R) праймерыTемпература, °СИсточник AGTrs5051F: 5'3AGCCCACAGCTCAGTTACAT33'60,0[7], с изм. R: 5'3TGGCCAAGTGATGTAACCCTC33' TGFB1rs1800469F: 5'3CACATGGGAGGTGCTCAGTA33'60,0
    Exact
    [8]
    Suffix
    , с изм. R: 5'3GTCAGGCTGGGAAACAAGGTA33' rs1800470F: 5'3CCTCCCCACCACACCAG33'58,5[8] rs1800471R: 5'3CCGCAGCTTGGACAGG33' ESR1rs2234693F: 5’3GATATCCAGGGTTATGTGGCA33’60,0[9] rs9340799R: 5’3AGGTGTTGCCTATTATATTAACCTTGA33’ VDRrs731236F: 5'3CAGAGCATGGACAGGGAGCAA33'63,0[10] R: 5'3GCAACTCCTCATGGCTGAGGTCTC33' Примечание: ОНП – однонуклеотидный полиморфизм. рекомендованных ее производителем.
    (check this in PDF content)

  9. Start
    23500
    Prefix
    цепной реакции Table 3 The structure and the temperature of annealing of primers for polymerase chain reaction ГенОНППрямой (F) и обратный (R) праймерыTемпература, °СИсточник AGTrs5051F: 5'3AGCCCACAGCTCAGTTACAT33'60,0[7], с изм. R: 5'3TGGCCAAGTGATGTAACCCTC33' TGFB1rs1800469F: 5'3CACATGGGAGGTGCTCAGTA33'60,0[8], с изм. R: 5'3GTCAGGCTGGGAAACAAGGTA33' rs1800470F: 5'3CCTCCCCACCACACCAG33'58,5
    Exact
    [8]
    Suffix
    rs1800471R: 5'3CCGCAGCTTGGACAGG33' ESR1rs2234693F: 5’3GATATCCAGGGTTATGTGGCA33’60,0[9] rs9340799R: 5’3AGGTGTTGCCTATTATATTAACCTTGA33’ VDRrs731236F: 5'3CAGAGCATGGACAGGGAGCAA33'63,0[10] R: 5'3GCAACTCCTCATGGCTGAGGTCTC33' Примечание: ОНП – однонуклеотидный полиморфизм. рекомендованных ее производителем.
    (check this in PDF content)

  10. Start
    23584
    Prefix
    R: 5'3TGGCCAAGTGATGTAACCCTC33' TGFB1rs1800469F: 5'3CACATGGGAGGTGCTCAGTA33'60,0[8], с изм. R: 5'3GTCAGGCTGGGAAACAAGGTA33' rs1800470F: 5'3CCTCCCCACCACACCAG33'58,5[8] rs1800471R: 5'3CCGCAGCTTGGACAGG33' ESR1rs2234693F: 5’3GATATCCAGGGTTATGTGGCA33’60,0
    Exact
    [9]
    Suffix
    rs9340799R: 5’3AGGTGTTGCCTATTATATTAACCTTGA33’ VDRrs731236F: 5'3CAGAGCATGGACAGGGAGCAA33'63,0[10] R: 5'3GCAACTCCTCATGGCTGAGGTCTC33' Примечание: ОНП – однонуклеотидный полиморфизм. рекомендованных ее производителем.
    (check this in PDF content)

  11. Start
    23677
    Prefix
    R: 5'3GTCAGGCTGGGAAACAAGGTA33' rs1800470F: 5'3CCTCCCCACCACACCAG33'58,5[8] rs1800471R: 5'3CCGCAGCTTGGACAGG33' ESR1rs2234693F: 5’3GATATCCAGGGTTATGTGGCA33’60,0[9] rs9340799R: 5’3AGGTGTTGCCTATTATATTAACCTTGA33’ VDRrs731236F: 5'3CAGAGCATGGACAGGGAGCAA33'63,0
    Exact
    [10]
    Suffix
    R: 5'3GCAACTCCTCATGGCTGAGGTCTC33' Примечание: ОНП – однонуклеотидный полиморфизм. рекомендованных ее производителем. Продукты рестрикции подвергались электрофоретическому разделению в полиакриламидном геле.
    (check this in PDF content)

  12. Start
    31791
    Prefix
    Стадии СОД определялись по результатам рентгенологического исследования органов грудной клетки согласно международным соглашениям и клиническим рекомендациям Российского респираторного общества
    Exact
    [6]
    Suffix
    . Выявлены ассоциации вариантов генов TGFB1 (rs1800469) и ESR1(rs9340799) с клиническими исходами ИИП (табл. 7), а также вариантов генов AGT (rs5051) и VDR(rs731236) со стадиями СОД (табл. 8).
    (check this in PDF content)

  13. Start
    36186
    Prefix
    В настоящее время опубликованы результаты нескольких полногеномных исследований (Genome' wide Association Studies(GWAS)) по выявлению генетических факторов, ассоциированных с развитием ИЗЛ
    Exact
    [11, 12]
    Suffix
    . Многократно подтверждена асcоциация вариантов генов главного комплекса гистосовместимости (человеческого лейкоцитарного антигена) HLAс развитием и течением ИЗЛ [13, 14]. Однако гены HLAне исчерпывают перечень генетических детерминант, способных влиять на патогенез и течение ИИП и СОД.
    (check this in PDF content)

  14. Start
    36373
    Prefix
    В настоящее время опубликованы результаты нескольких полногеномных исследований (Genome' wide Association Studies(GWAS)) по выявлению генетических факторов, ассоциированных с развитием ИЗЛ [11, 12]. Многократно подтверждена асcоциация вариантов генов главного комплекса гистосовместимости (человеческого лейкоцитарного антигена) HLAс развитием и течением ИЗЛ
    Exact
    [13, 14]
    Suffix
    . Однако гены HLAне исчерпывают перечень генетических детерминант, способных влиять на патогенез и течение ИИП и СОД. Исследована ассоциация вариантов генов AGT, TGFB1, ESR1и VDRс развитием и течением ИИП и СОД.
    (check this in PDF content)

  15. Start
    36711
    Prefix
    Исследована ассоциация вариантов генов AGT, TGFB1, ESR1и VDRс развитием и течением ИИП и СОД. Ассоциации с риском упомянутых заболеваний не выявлено, что согласуется с полученными ранее результатами
    Exact
    [15]
    Suffix
    . Однако в настоящей работе выявлены ассоциации вариантов генов TGFB1 (rs1800469) и ESR1(rs9340799) с клиническими исходами ИИП, а также генов AGT(rs5051) и VDR (rs731236) со стадиями СОД.
    (check this in PDF content)

  16. Start
    37290
    Prefix
    Это согласуется с результатами C.Arja et al., в работе которых вариант rs1800469 Т ассоциировался с лучшими показателями легочных функций у больных хронической обструктивной болезнью легких мужчинкурильщиков
    Exact
    [16]
    Suffix
    . Трансформирующий фактор роста-β1(TGF-β1) представляет собой многофункциональный цитокин, регулирующий клеточную пролиферацию и дифференцировку, клеточную адгезию, передачу сигналов между клетками, продукцию и деградацию внеклеточного матрикса.
    (check this in PDF content)

  17. Start
    37651
    Prefix
    Трансформирующий фактор роста-β1(TGF-β1) представляет собой многофункциональный цитокин, регулирующий клеточную пролиферацию и дифференцировку, клеточную адгезию, передачу сигналов между клетками, продукцию и деградацию внеклеточного матрикса. В дыхательной системе TGF-β1играет важную роль в процессах воспаления и ремоделирования
    Exact
    [17]
    Suffix
    . У носителей генотипа rs1800469 ТТ гена TGFB1концентрация TGF-β1в плазме почти в 2 раза выше, чем у носителей генотипа rs1800469 СС [18]. Рассматриваемые в нашей работе ОНП гена ESR1 расположены в интроне 1, вблизи промотора.
    (check this in PDF content)

  18. Start
    37794
    Prefix
    В дыхательной системе TGF-β1играет важную роль в процессах воспаления и ремоделирования [17]. У носителей генотипа rs1800469 ТТ гена TGFB1концентрация TGF-β1в плазме почти в 2 раза выше, чем у носителей генотипа rs1800469 СС
    Exact
    [18]
    Suffix
    . Рассматриваемые в нашей работе ОНП гена ESR1 расположены в интроне 1, вблизи промотора. Особенностью 1-го интрона по сравнению с остальными интронами является повышенное содержание в нем регуляторных последовательностей.
    (check this in PDF content)

  19. Start
    38578
    Prefix
    В клетках человека выявлены множество транскриптов гена ESR1, являющихся результатом альтернативного сплайсинга; при этом на процессинг мРНК могут оказывать влияние как ОНП rs2234693, так и ОНП rs9340799
    Exact
    [19]
    Suffix
    . Эстрогеновые рецепторы представлены не только в репродуктивных органах, но и во многих других частях организма. В легких ESR1экспрессируется в структурных клетках, в т. ч. миофибробластах, и воздействие на эти клетки эстрогенов приводит к снижению пролиферации [20].
    (check this in PDF content)

  20. Start
    38863
    Prefix
    Эстрогеновые рецепторы представлены не только в репродуктивных органах, но и во многих других частях организма. В легких ESR1экспрессируется в структурных клетках, в т. ч. миофибробластах, и воздействие на эти клетки эстрогенов приводит к снижению пролиферации
    Exact
    [20]
    Suffix
    . Выявлена ассоциация варианта rs9340799 X (G) с неблагоприятным течением ИИП. Интересно отметить, что в работе G.H.Koppelman et al., посвященной бронхиальной астме, в качестве неблагоприятного фактора выявлен, наоборот, вариант rs9340799 АА, ассоциированный со снижением объема форсированного выдоха за 1-ю секунду [20].
    (check this in PDF content)

  21. Start
    39203
    Prefix
    Интересно отметить, что в работе G.H.Koppelman et al., посвященной бронхиальной астме, в качестве неблагоприятного фактора выявлен, наоборот, вариант rs9340799 АА, ассоциированный со снижением объема форсированного выдоха за 1-ю секунду
    Exact
    [20]
    Suffix
    . Возможно, такое различие результатов является примером нередкой Таблица 8 Ассоциации вариантов генов AGT и VDR со стадиями саркоидоза органов дыхания Table 8 Associations of AGT and VDR gene variants with pulmonary sarcoidosis stage ОНП и обусловленныйЧастота встречаемости варианта генаРазличия подгруппОШ95%3ный ДИ им вариант гена(число носителей) 0–I стадии СОДII–IV стадии СОДχ2dfp n= 26n=
    (check this in PDF content)

  22. Start
    40758
    Prefix
    Известно, что ангиотензин является ростовым фактором, который играет важную роль в патогенезе ИИП. Ангиотензин в экспериментальных моделях пневмофиброза проявил себя как проапоптотический и профибротический фактор
    Exact
    [21]
    Suffix
    . В работе M.Molina'Molina et al. показано, что вариант rs5051 А гена AGTне ассоциирован с предрасположенностью к ИИП, но ассоциирован с более тяжелым течением этого заболевания [15].
    (check this in PDF content)

  23. Start
    40954
    Prefix
    Ангиотензин в экспериментальных моделях пневмофиброза проявил себя как проапоптотический и профибротический фактор [21]. В работе M.Molina'Molina et al. показано, что вариант rs5051 А гена AGTне ассоциирован с предрасположенностью к ИИП, но ассоциирован с более тяжелым течением этого заболевания
    Exact
    [15]
    Suffix
    . Предполагается, что в случае СОД реализуется тот же принцип, как и при ИИП – более функционально активный аллель А гена AGTобеспечивает повышенную концентрацию ангиотензиногена и, соответственно, ангиотензина в плазме крови, приводя к повышению давления в легочной артерии и стимуляции апоптоза и фиброза в легких.
    (check this in PDF content)

  24. Start
    41652
    Prefix
    Показана ассоциация варианта rs731236 гена VDR со стадиями СОД. Ранее при полногеномном исследовании выявлена ассоциация локуса 12q13.3–q14.1, в котором расположен ген VDR, с развитием саркоидоза
    Exact
    [11]
    Suffix
    . Предполагается, что белковый продукт аллеля rs731236 t (C) гена VDRобладает сниженным сродством к витамину D, что затрудняет взаимодействие витамина D с его рецептором и, соответственно, снижает эффективность подавления гранулематозного воспаления при СОД, способствуя более тяжелому его течению.
    (check this in PDF content)

  25. Start
    42320
    Prefix
    Так, описана ассоциация rs731236 с хроническим периодонтитом; при носительстве аллеля t (С) и генотипа tt (СС) повышался риск развития хронического периодонтита в 2,4 и 4,6 раза соответственно
    Exact
    [22]
    Suffix
    . В исследованииL.Perna et al. среди носителей варианта rs731236 tt (CC) отмечена более высокая смертность от рака молочной железы [23]. Витамин D является важным модулятором иммунного ответа; не вызывает сомнений нарушение регуляции синтеза витамина D у больных саркоидозом [24].
    (check this in PDF content)

  26. Start
    42461
    Prefix
    Так, описана ассоциация rs731236 с хроническим периодонтитом; при носительстве аллеля t (С) и генотипа tt (СС) повышался риск развития хронического периодонтита в 2,4 и 4,6 раза соответственно [22]. В исследованииL.Perna et al. среди носителей варианта rs731236 tt (CC) отмечена более высокая смертность от рака молочной железы
    Exact
    [23]
    Suffix
    . Витамин D является важным модулятором иммунного ответа; не вызывает сомнений нарушение регуляции синтеза витамина D у больных саркоидозом [24]. Моноциты и макрофаги в очагах гранулематозного воспаления при саркоидозе синтезируют активную форму витамина D (1,25-дигидроксивитамин D3) из прекурсора.
    (check this in PDF content)

  27. Start
    42616
    Prefix
    В исследованииL.Perna et al. среди носителей варианта rs731236 tt (CC) отмечена более высокая смертность от рака молочной железы [23]. Витамин D является важным модулятором иммунного ответа; не вызывает сомнений нарушение регуляции синтеза витамина D у больных саркоидозом
    Exact
    [24]
    Suffix
    . Моноциты и макрофаги в очагах гранулематозного воспаления при саркоидозе синтезируют активную форму витамина D (1,25-дигидроксивитамин D3) из прекурсора. Витамин D осуществляет свои эффекты через ядерный рецептор, кодируемый геном VDR.
    (check this in PDF content)

  28. Start
    42963
    Prefix
    Моноциты и макрофаги в очагах гранулематозного воспаления при саркоидозе синтезируют активную форму витамина D (1,25-дигидроксивитамин D3) из прекурсора. Витамин D осуществляет свои эффекты через ядерный рецептор, кодируемый геном VDR. Рецепторы витамина D обнаружены в активированных пролиферирующих лимфоцитах
    Exact
    [25]
    Suffix
    . В данном исследовании в выборке ИИП ассоциации с клиническими параметрами выявлены для вариантов генов TGFB1и ESR1, а в выборке СОД – для вариантов генов AGTи VDR. Это свидетельствует о том, что ИИП и СОД, несмотря на ряд общих черт (поражение легочного интерстиция с исходом в пневмофиброз, неясная этиология, хроническое течение, неинфекционность, улучшение состояния н
    (check this in PDF content)

  29. Start
    44582
    Prefix
    Новейшие публикации свидетельствуют о том, что даже в пределах одной нозологии различные клинические фенотипы могут иметь в своей основе различные молекулярные механизмы, подверженные влияниям различных генетических детерминант
    Exact
    [26]
    Suffix
    . Следовательно, при планировании дальнейших работ необходимо уделять пристальное внимание критериям формирования выборок для повышения таргетности молекулярно-генетического исследования.
    (check this in PDF content)