The 18 reference contexts in paper A. Chukhlovin B., N. Kuzubova A., N. Elshin D., O. Titova N., А. Чухловин Б., Н. Кузубова А., Н. Елшин Д., О. Титова Н. (2015) “Экспрессия генов ADRB2 и CHRM3 в лейкоцитах крови у больных с обострением хронической обструктивной болезни легких // ADRB2 and CHRM3 gene expression in blood leukocytes of patients with acute exacerbation of chronic obstructive pulmonary disease” / spz:neicon:pulmonology:y:2015:i:2:p:151-156

  1. Start
    3158
    Prefix
    В современные протоколы лечения хронической обструктивной болезни легких (ХОБЛ) включена комплексная курсовая терапия бронхолитическими препаратами, основанная на сочетании адренергических и антихолинергических эффектов
    Exact
    [1]
    Suffix
    . Клиническая эффективность данных препаратов при ХОБЛ сопоставима, однако β2-агонисты являются более быстродействующими, тогда как антихолинергические средства характеризуются лучшей переносимостью и меньшим риском побочных эффектов.
    (check this in PDF content)

  2. Start
    3504
    Prefix
    Клиническая эффективность данных препаратов при ХОБЛ сопоставима, однако β2-агонисты являются более быстродействующими, тогда как антихолинергические средства характеризуются лучшей переносимостью и меньшим риском побочных эффектов. Такая комбинированная терапия связана с их взаимодополняющим лечебным действием
    Exact
    [2]
    Suffix
    . Мускариновые рецепторы и β-адренорецепторы являются физиологическими антагонистами в регуляции тонуса гладких мышц дыхательных путей [3]. В то же время при использовании одного из этих препаратов в качестве базисной терапии изменяется не только экспрессия целевого рецептора, но и рецептора противоположной направленности.
    (check this in PDF content)

  3. Start
    3646
    Prefix
    Такая комбинированная терапия связана с их взаимодополняющим лечебным действием [2]. Мускариновые рецепторы и β-адренорецепторы являются физиологическими антагонистами в регуляции тонуса гладких мышц дыхательных путей
    Exact
    [3]
    Suffix
    . В то же время при использовании одного из этих препаратов в качестве базисной терапии изменяется не только экспрессия целевого рецептора, но и рецептора противоположной направленности. Основные фармакологические эффекты β-адренергических препаратов связаны с их влиянием на β2-адренорецепторы, которые локализуются в мембранах клеток дыхательных путей.
    (check this in PDF content)

  4. Start
    4432
    Prefix
    содержание рецепторов ADRB2 отмечается в гладкомышечных структурах воздухоносных путей (30–40 000 на 1 клетку), а также в клетках легочного эпителия, эндотелия и альвеолоцитов 2-го типа. Кроме того, они обнаруживаются во многих других клетках и тканях, в т. ч. в лейкоцитах (Т- и В-лимфоцитах, тучных клетках и т. п.), эндотелии и юкстагломерулярных клетках почек
    Exact
    [4, 5]
    Suffix
    . Показано, что в популяциях лимфоцитов человека обнаруживаются адренорецепторы всех 3 основных классов (ADRB1, ADRB2 и ADRB3), причем их связывающая активность и уровни экспрессии существенно различаются в зависимости от состояния макроорганизма [5].
    (check this in PDF content)

  5. Start
    4706
    Prefix
    Показано, что в популяциях лимфоцитов человека обнаруживаются адренорецепторы всех 3 основных классов (ADRB1, ADRB2 и ADRB3), причем их связывающая активность и уровни экспрессии существенно различаются в зависимости от состояния макроорганизма
    Exact
    [5]
    Suffix
    . Холинергические мускариновые рецепторы в легких человека выявляются в основном в гладкомыhttp://journal.pulmonology.ru151 шечных клетках, эпителии и фибробластах легких. Кроме того, существуют многочисленные данные о наличии N- и M-холинорецепторов в Т- и В-лимфоцитах [6], т. к. выработка ацетилхолина значительно возрастает под влиянием неспецифических и специфических
    (check this in PDF content)

  6. Start
    4997
    Prefix
    Холинергические мускариновые рецепторы в легких человека выявляются в основном в гладкомыhttp://journal.pulmonology.ru151 шечных клетках, эпителии и фибробластах легких. Кроме того, существуют многочисленные данные о наличии N- и M-холинорецепторов в Т- и В-лимфоцитах
    Exact
    [6]
    Suffix
    , т. к. выработка ацетилхолина значительно возрастает под влиянием неспецифических и специфических митогенных факторов лимфоцитов. Таким образом, холинергическая система лимфоцитов может быть важным звеном "иммунного синапса" в организме человека.
    (check this in PDF content)

  7. Start
    7090
    Prefix
    При поступлении и по завершении лечения проводилось спирометрическое обследование на аппарате "Мас\u0019 тер-Скрин" (E.Jaeger, Германия). Отклонение спирометрических параметров оценивалось по градации
    Exact
    [7]
    Suffix
    . Содержание лейкоцитов, эритроцитов и тромбоцитов, а также сывороточные маркеры системного воспаления (С-реактивный белок – СРБ и т. п.) определялись по стандартным методикам в лаборатории СПб ГУЗ "Введенская городская клиническая больница".
    (check this in PDF content)

  8. Start
    9097
    Prefix
    Таблица Олигонуклеотиды, использованные в данном исследовании (условия ПЦР указаны в тексте) Table Oligonucleotides used in this study (PCR technique is described in the text) Название геновПоследовательность олигонуклеотидовИсточник ADRB2S.Moniotte, 2001
    Exact
    [8]
    Suffix
    Смысловой5'+CCGAAAGTTCCCGTACGTCA+3' Антисмысловой5'+CAGCCCGTGCTCTGAAGAA+3' Taqman+зонд5'+FAM+TGCACATAACGGGCAGAACGCACT+BHQ1+3' CHRM3Оригинал GenBank: X15266.1 Смысловой5'+TCTACTCCATCGTGCTCAA+3' Антисмысловой5'+TCTCCAAGTCCACCATCC+3' Taqman+зонд5'+FAM+CGGGTCACAGCACCATCCTCAACT+BHQ1+3' GAPDHN.
    (check this in PDF content)

  9. Start
    9395
    Prefix
    in the text) Название геновПоследовательность олигонуклеотидовИсточник ADRB2S.Moniotte, 2001 [8] Смысловой5'+CCGAAAGTTCCCGTACGTCA+3' Антисмысловой5'+CAGCCCGTGCTCTGAAGAA+3' Taqman+зонд5'+FAM+TGCACATAACGGGCAGAACGCACT+BHQ1+3' CHRM3Оригинал GenBank: X15266.1 Смысловой5'+TCTACTCCATCGTGCTCAA+3' Антисмысловой5'+TCTCCAAGTCCACCATCC+3' Taqman+зонд5'+FAM+CGGGTCACAGCACCATCCTCAACT+BHQ1+3' GAPDHN.Patel, 2013
    Exact
    [9]
    Suffix
    Смысловой5'+AACCTGCCAAGTATGATGACATC+3' Антисмысловой5'+GTAGCCCAGGATGCCCTTGA+3' Taqman+зонд5'+FAM+ CTCCGACGCCTGCTTCACCACCTTCT+BHQ1+3' 152Пульмонология. 2015; 25 (2): 151–156 Этот показатель использовался для реальной оценки повышения или понижения уровней специфического гена в индивидуальных образцах мРНК из лейкоцитов крови.
    (check this in PDF content)

  10. Start
    12982
    Prefix
    Известно, что ингаляционная терапия β2-агонистами адренорецепторов и М-холинолитическими препаратами сопровождается существенными внелегочными эффектами на сердечно-сосудистую систему и клетки циркулирующей крови
    Exact
    [10, 11]
    Suffix
    , Рис. 1. Зависимость между изменениями уровней СРБ и величинами экспрессии мРНК ADRB2 после курса комплексной терапии адрено- и холинергическими препаратами (n= 16; r= –0,63; p= 0,006 по критерию Спирмена) Figure 1.
    (check this in PDF content)

  11. Start
    15182
    Prefix
    Важная функция препаратов-агонистов адренорецепторов связана с их противовоспалительным действием, которое реализуется через ингибирование экспрессии адренорецепторов на иммунных клеткахнейтрофилах, эозинофилах и лимфоцитах
    Exact
    [12]
    Suffix
    . При длительном применении адренергических препаратов может снизиться число адренорецепторов [13]. Показана корреляция между повышенной экспрессией мРНК гена ADRB2 и снижением содержания СРБ после терапии, что соответствует противовоспалительному эффекту от проведенного лечения.
    (check this in PDF content)

  12. Start
    15284
    Prefix
    Важная функция препаратов-агонистов адренорецепторов связана с их противовоспалительным действием, которое реализуется через ингибирование экспрессии адренорецепторов на иммунных клеткахнейтрофилах, эозинофилах и лимфоцитах [12]. При длительном применении адренергических препаратов может снизиться число адренорецепторов
    Exact
    [13]
    Suffix
    . Показана корреляция между повышенной экспрессией мРНК гена ADRB2 и снижением содержания СРБ после терапии, что соответствует противовоспалительному эффекту от проведенного лечения.
    (check this in PDF content)

  13. Start
    15877
    Prefix
    Существенное влияние на рецепторы лейкоцитов оказывают также ГКС, применяемые в данном лечебном протоколе. Как известно, при ингаляциях комбинированных бронхолитических препаратов значительная часть ГКС попадает в кровоток, оказывая таким образом системные эффекты на лейкоциты
    Exact
    [14, 15]
    Suffix
    . В ряде исследований показано, что при длительном применении ГКС повышается экспрессия β2-адренорецепторов путем усиления транскрипции гена ADRB2. При этом сенсибилизируются β-рецепторы дыхательных путей, что поддерживает бронходилатационный эффект β-агонистов длительного действия [16].
    (check this in PDF content)

  14. Start
    16186
    Prefix
    В ряде исследований показано, что при длительном применении ГКС повышается экспрессия β2-адренорецепторов путем усиления транскрипции гена ADRB2. При этом сенсибилизируются β-рецепторы дыхательных путей, что поддерживает бронходилатационный эффект β-агонистов длительного действия
    Exact
    [16]
    Suffix
    . Под влиянием ГКС снижается уровень β-аррестина-2 (фактор, инактивирующий β2-адренорецепторы), что приводит к более выраженной и длительной релаксации гладкомышечных клеток дыхательных путей [17].
    (check this in PDF content)

  15. Start
    16400
    Prefix
    Под влиянием ГКС снижается уровень β-аррестина-2 (фактор, инактивирующий β2-адренорецепторы), что приводит к более выраженной и длительной релаксации гладкомышечных клеток дыхательных путей
    Exact
    [17]
    Suffix
    . Таким образом, при совместном применении бронхолитических препаратов обоих классов на фоне ингаляционной терапии взаимно усиливается двойной терапевтический эффект (как противовоспалительный, так и бронходилатационный), что соответствует современным представлениям об эффективности сочетанного применения бронхолитических препаратов у больных ХОБЛ.
    (check this in PDF content)

  16. Start
    16848
    Prefix
    бронхолитических препаратов обоих классов на фоне ингаляционной терапии взаимно усиливается двойной терапевтический эффект (как противовоспалительный, так и бронходилатационный), что соответствует современным представлениям об эффективности сочетанного применения бронхолитических препаратов у больных ХОБЛ. Что касается локальной экспрессии генов М-холинорецепторов, то в работе
    Exact
    [18]
    Suffix
    показано, что в слизистой оболочке бронхов у больных ХОБЛ экспрессия мРНК CHRM3 была существенно ниже у лиц с ХОБЛ по сравнению с пациентами с бронхиальной астмой, а экспрессия генов M3-холинорецепторов была значительно выше у больных ХОБЛ с гиперреактивностью бронхов, чем в остальных случаях ХОБЛ.
    (check this in PDF content)

  17. Start
    17479
    Prefix
    Вероятно, у пациентов с обратимой обструкцией имеется более высокий уровень экспрессии генов М3-холинорецепторов, что подтверждается в современных работах на тему необходимости применения холинолитических препаратов у больных с определенными фенотипами бронхиальной астмы
    Exact
    [19]
    Suffix
    . При снижении уровней мРНК CHRM3 в лейкоцитах крови после комбинированной терапии отражается специфический бронходилатационный эффект препарата, о чем свидетельствует увеличение показателей ОФВ1при снижении экспрессии CHRM3 под влиянием холинолитических препаратов.
    (check this in PDF content)

  18. Start
    18327
    Prefix
    Антимускариновые препараты оказались эффективными в лечении бронхообструктивных заболеваний. В случае назначения как ингаляционных ГКС, так иβ-агонистов усиливается аддитивный эффект, проявляющийся в подавлении экспрессии М-холинорецепторов в дыхательных путях
    Exact
    [20]
    Suffix
    . Следовательно, препараты в данном сочетании имеют однонаправленный механизм действия, оптимизируя функции холинорецепторов, что способствует достижению более выраженного клинического эффекта у больных с бронхиальной обструкцией, в т. ч.
    (check this in PDF content)