1. Start
    Immunol., 2007, vol. 9, N 4-5, pp 457-466) Введение Функционирование системы интерферона (IFN) является важной составляющей антивирусного, антипролиферативного и иммунного ответов на вирусную инфекцию
    . Человеческие IFN разделены на типы I и II [11, 14]. Первый тип включает многочисленные подтипы IFNα, а также IFNβ, IFNω, IFNτ, IFNκ, IFNε, IFNλ и IFNξ. Ко второму типу относится IFNγ. В настоящее время наиболее изучены α (лейкоцитарный), β (фибробластный) и γ (иммунный) IFN, которые производятся как лекарственные средства.
    (check this in PDF content)

  2. Start
    Immunol., 2007, vol. 9, N 4-5, pp 457-466) Введение Функционирование системы интерферона (IFN) является важной составляющей антивирусного, антипролиферативного и иммунного ответов на вирусную инфекцию [2]. Человеческие IFN разделены на типы I и II
    [11, 14]
    . Первый тип включает многочисленные подтипы IFNα, а также IFNβ, IFNω, IFNτ, IFNκ, IFNε, IFNλ и IFNξ. Ко второму типу относится IFNγ. В настоящее время наиболее изучены α (лейкоцитарный), β (фибробластный) и γ (иммунный) IFN, которые производятся как лекарственные средства.
    (check this in PDF content)

  3. Start
    В настоящее время известна первичная структура экспрессируемых мРНК 12 видов IFNα из нескольких типов клеток и только по одному виду IFNβ и IFNγ (MGC cDNA libraries, NCBI,
    . Хотя IFN типа I связываются на поверхности клеток с общим рецептором, состоящим из 2-х трансмембранных субъединиц (АR-1 и АR-2), между IFNα и IFNβ имеются отличия в индуцируемых сигнальных процессах [11].
    (check this in PDF content)

  4. Start
    Хотя IFN типа I связываются на поверхности клеток с общим рецептором, состоящим из 2-х трансмембранных субъединиц (АR-1 и АR-2), между IFNα и IFNβ имеются отличия в индуцируемых сигнальных процессах
    . IFNγ имеет другой рецептор связывания с клетками – GR, также состоящий из 2-х субъединиц (GR1 и GR2). После взаимодействия IFN со специфическими рецепторами происходит активация тирозиновых киназ (JAK) и фосфорилирование латентных цитоплазматических факторов транскрипции (STAT).
    (check this in PDF content)

  5. Start
    В передаче сигнала IFNγ участвуют тирозиновые киназы JAK-1 и JAK-2 и гомодимер фактора транскрипции STAT1, который, транслоцируясь в ядро, взаимодействует с γ-активируемой последовательностью (GAS), найденной в IFNγ-зависимых генах. При вирусной инфекции происходит преимущественная активация IFN-регулируемого фактора IRF-3, а также дополнительно факторов IRF-7 и IRF-9
    . ДНК- и РНК-содержащие вирусы кодируют белки, нарушающие процесс сигнальной активации JAK-STAT IFN-генов [20]. Имеющиеся данные показывают, что вирусы, относящиеся к разным таксономическим группам (герпеса, гриппа, гепатита А, энцефалита, иммунодефицита человека), используют неодинаковые механизмы как индукции, так и подавления активности генов системы IFN [9, 15, 19, 25, 26].
    (check this in PDF content)

  6. Start
    При вирусной инфекции происходит преимущественная активация IFN-регулируемого фактора IRF-3, а также дополнительно факторов IRF-7 и IRF-9 [27]. ДНК- и РНК-содержащие вирусы кодируют белки, нарушающие процесс сигнальной активации JAK-STAT IFN-генов
    . Имеющиеся данные показывают, что вирусы, относящиеся к разным таксономическим группам (герпеса, гриппа, гепатита А, энцефалита, иммунодефицита человека), используют неодинаковые механизмы как индукции, так и подавления активности генов системы IFN [9, 15, 19, 25, 26].
    (check this in PDF content)

  7. Start
    Имеющиеся данные показывают, что вирусы, относящиеся к разным таксономическим группам (герпеса, гриппа, гепатита А, энцефалита, иммунодефицита человека), используют неодинаковые механизмы как индукции, так и подавления активности генов системы IFN
    [9, 15, 19, 25, 26]
    . Анализ экспрессии клеточных генов в фибробластах человека, зараженных ЦМВ, выполненный с применением технологии ДНК-чипов, показал изменения активности более чем 250 генов [8, 17, 33]. Наибо лее выраженная реакция наблюдалась в группе IFNзависимых генов и генов, участвующих в контроле клеточной пролиферации и программированной клеточной гибели (апоптоза).
    (check this in PDF content)

  8. Start
    к разным таксономическим группам (герпеса, гриппа, гепатита А, энцефалита, иммунодефицита человека), используют неодинаковые механизмы как индукции, так и подавления активности генов системы IFN [9, 15, 19, 25, 26]. Анализ экспрессии клеточных генов в фибробластах человека, зараженных ЦМВ, выполненный с применением технологии ДНК-чипов, показал изменения активности более чем 250 генов
    [8, 17, 33]
    . Наибо лее выраженная реакция наблюдалась в группе IFNзависимых генов и генов, участвующих в контроле клеточной пролиферации и программированной клеточной гибели (апоптоза). Уровень стимуляции генной активности отдельных IFN-регулируемых генов нативным (инфекционным) ЦМВ по сравнению с инактивированным (неинфекционным) был заметно ниже.
    (check this in PDF content)

  9. Start
    Уровень стимуляции генной активности отдельных IFN-регулируемых генов нативным (инфекционным) ЦМВ по сравнению с инактивированным (неинфекционным) был заметно ниже. Поэтому ЦМВ скорее негативно регулировал клеточный антивирусный ответ. Так, ЦМВ нарушал экспрессию генов IFN и МНС класса II, снижая уровень JAK1 в результате деградации
    . Установлено, что вирионный белок рр65 ЦМВ подавлял процесс сигнальной трансдукции генов клеточной защиты [7, 9]. Применив специальный метод (SVD-ДНК-чип анализ) для оценки ранее полученных данных действия ЦМВинфекции на транкрипцию генов человека, были выявлены новые функционально-важные гены, участвующие в регуляции транскрипции, клеточного цикла, онкогенеза, иммунного и интерферонного отв
    (check this in PDF content)

  10. Start
    Так, ЦМВ нарушал экспрессию генов IFN и МНС класса II, снижая уровень JAK1 в результате деградации [24]. Установлено, что вирионный белок рр65 ЦМВ подавлял процесс сигнальной трансдукции генов клеточной защиты
    [7, 9]
    . Применив специальный метод (SVD-ДНК-чип анализ) для оценки ранее полученных данных действия ЦМВинфекции на транкрипцию генов человека, были выявлены новые функционально-важные гены, участвующие в регуляции транскрипции, клеточного цикла, онкогенеза, иммунного и интерферонного ответа [10].
    (check this in PDF content)

  11. Start
    Применив специальный метод (SVD-ДНК-чип анализ) для оценки ранее полученных данных действия ЦМВинфекции на транкрипцию генов человека, были выявлены новые функционально-важные гены, участвующие в регуляции транскрипции, клеточного цикла, онкогенеза, иммунного и интерферонного ответа
    . Вместе с тем многие вопросы, связанные с функционированием генов системы IFN в ЦМВ-инфицированных клетках, остаются нерешенными. К ним относятся такие, как зависимость экспрессии индивидуальных генов IFN I и II типа от скорости и формы развития ЦМВинфекции (острая и латентная).
    (check this in PDF content)

  12. Start
    Синхронизация фибробластов в состоянии пролиферативного покоя (G0) и синтеза ДНК (S) достигалась лишением клеток сывороточных факторов роста на 48 ч с последующей стимуляцией пролиферации путем добавления среды с 15% ЭТС
    . Эксперименты на контрольных (незараженных) и опытных (зараженных ЦМВ) клетках ставили параллельно. Сроки исследования составляли 0, 3, 6, 12, 24, 48, 72 и 120 ч (см. раздел Результаты). Содержание мРНК α-, β- и IFNγ определяли с помощью полуколичественного варианта метода обратная транскрипция – полимеразная цепная реакция (ОТ-ПЦР) [3, 13].
    (check this in PDF content)

  13. Start
    Сроки исследования составляли 0, 3, 6, 12, 24, 48, 72 и 120 ч (см. раздел Результаты). Содержание мРНК α-, β- и IFNγ определяли с помощью полуколичественного варианта метода обратная транскрипция – полимеразная цепная реакция (ОТ-ПЦР)
    [3, 13]
    . Для выделения суммарной клеточной РНК использовали метод гуанидин-тиоцианат-фенол-хлороформ [12]. Реакцию обратной транскрипции (ОТ) проводили на матрице поли(А)РНК с универсальным праймером олиго(дТ)16 и ферментом обратная транскриптаза (200 ед/мкл MBI «Fermentas» Латвия) при 42°С 1 ч.
    (check this in PDF content)

  14. Start
    Содержание мРНК α-, β- и IFNγ определяли с помощью полуколичественного варианта метода обратная транскрипция – полимеразная цепная реакция (ОТ-ПЦР) [3, 13]. Для выделения суммарной клеточной РНК использовали метод гуанидин-тиоцианат-фенол-хлороформ
    . Реакцию обратной транскрипции (ОТ) проводили на матрице поли(А)РНК с универсальным праймером олиго(дТ)16 и ферментом обратная транскриптаза (200 ед/мкл MBI «Fermentas» Латвия) при 42°С 1 ч. Аликвоты полученных кДНК без разведения и в 10-кратных разведениях (от 10-1 до 10-4) амплифицировали в ПЦР со специфическими парами праймеров, рассчитанными нами по известным нуклеотидным последовательно
    (check this in PDF content)

  15. Start
    Аликвоты полученных кДНК без разведения и в 10-кратных разведениях (от 10-1 до 10-4) амплифицировали в ПЦР со специфическими парами праймеров, рассчитанными нами по известным нуклеотидным последовательностям мРНК IFNα, β и γ
    [3, 4]
    . Условия проведения ПЦР: 50 циклов амплификации на матрицах кДНК с термостабильной Taq-полимеразой (5 ед/мкл MBI «Fermentas», Латвия) при температуре отжига 53-55°С (точно соответствующим рассчитанным для каждой пары праймеров).
    (check this in PDF content)

  16. Start
    Проведено выравнивание всех известных нуклеотидных последовательностей, экспрессируемых мРНК разных видов α-, β- и γ-интерферонов, которые представлены последовательностями MGC в NCBI Генбанке (
    . Анализ взаимодействия использованных олигонуклеотидных праймеров с исследованными матрицами показал, что пара праймеров для IFNα универсальна. Прямой праймер безошибочно связывается с кДНК 5-ти разновидностей IFNα (4, 7, 8, 17 и 21), а обратный – комплементарен участкам мРНК 7-ми вариантов IFNα (1, 2, 4, 7, 13, 14 и 21) (рис. 1).
    (check this in PDF content)

  17. Start
    Прямой праймер безошибочно связывается с кДНК 5-ти разновидностей IFNα (4, 7, 8, 17 и 21), а обратный – комплементарен участкам мРНК 7-ми вариантов IFNα (1, 2, 4, 7, 13, 14 и 21) (рис. 1). Пары праймеров для мРНК IFNβ и IFNγ являются высокоспецифичными, так как связываются только с собственными матрицами
    . Выявление вирусных белков (IEp72, рp65, gB) в клетках на разных сроках ЦМВ-инфекции проводили методом иммуноферментного анализа in situ с использованием моноклональных антител (МКА) [6]. Клетки, окрашенные МКА, подсчитывали и выражали в процентах от общего числа клеток.
    (check this in PDF content)

  18. Start
    Пары праймеров для мРНК IFNβ и IFNγ являются высокоспецифичными, так как связываются только с собственными матрицами [3]. Выявление вирусных белков (IEp72, рp65, gB) в клетках на разных сроках ЦМВ-инфекции проводили методом иммуноферментного анализа in situ с использованием моноклональных антител (МКА)
    . Клетки, окрашенные МКА, подсчитывали и выражали в процентах от общего числа клеток. Инфекционный титр ЦМВ определяли микрометодом «черных бляшек» под агаровым покрытием с помощью смеси МКА к структурным ЦМВ-белкам (рр65 и gB) [1].
    (check this in PDF content)

  19. Start
    Клетки, окрашенные МКА, подсчитывали и выражали в процентах от общего числа клеток. Инфекционный титр ЦМВ определяли микрометодом «черных бляшек» под агаровым покрытием с помощью смеси МКА к структурным ЦМВ-белкам (рр65 и gB)
    . Результаты Развитие ЦМВ инфекции в культурах диплоидных фибробластов, отличающихся пролиферативным состоянием и чувствительностью к вирусу В изученных линиях диплоидных фибробластов человека ФЛЭЧ-110044, ФЛЭЧ-977 и ФКЧ1608, находящихся в момент заражения в 2-х пролиферативных состояниях покоя (G0) или в фазе синтеза ДНК (S), сравнили динамику развития инфекционного процесса, которая характе
    (check this in PDF content)

  20. Start
    Наблюдение за жизнеспособностью клеток позволило установить, что гибель большей части клеточной популяции (ЦПД вируса) в культуре покоящихся ФЛЭЧ110044 происходила на 4-5 день. В пролиферирующих клетках клеточная гибель наступала намного позднее, только на 10-11 день, и сопровождалась патологическими митозами
    . Сравнительное изучение клеточной резистентности к ЦМВ проводили на 2-х клеточных линиях фибробластов человека (ФЛЭЧ-977 и ФКЧА alpha 4 GGCCTTGATACTCCTGGCACA alpha 7 ..................... alpha 21 ..................... alpha 17 ..................... alpha 8 ..................... alpha 10 .
    (check this in PDF content)

  21. Start
    Продукция инфекционного вируса чувствительными эмбриональными клетками была в 2,5 раза больше (6 lg БОЕ/ мл) и их гибель наступала раньше (на 2-3 день). На основании этих данных линия клеток ФЛЭЧ977 отнесена к высокочувствительной к ЦМВ, а линия клеток ФКЧ-1608 обладала резистентностью к ЦМВ
    . Транскрипционная активность IFN-генов в фибробластах человека, отличающихся пролиферативным состоянием и чувствительностью к ЦМВ Сравнительное определение конститутивных уровней экспрессии IFN-генов в диплоидных фибробластах человека, находившихся в состоянии пролиферативного покоя и в фазе синтеза ДНК показало, что в S-фазе клеточного цикла у фибробластов линии ФЛЭЧ-110044 активность ге
    (check this in PDF content)

  22. Start
    Это означает, что в фибробластах человека транскрипционная активность генов IFNα позитивно коррелирует с уровнем синтеза клеточной ДНК. Можно предположить, что в регуляции генов IFNα принимают участие известные регуляторы клеточного цикла и синтеза клеточной ДНК (р53, циклин-зависимых киназ, E2F и др.)
    . Высокие уровни транскрипции мРНК IFNα в фазе синтеза ДНК, которые определяются полуколичественной ОТПЦР в разведении кДНК в 1000 раз, не сопровождаются секрецией из клеток биологически активного IFN (данные не приводятся).
    (check this in PDF content)

  23. Start
    Поэтому уровень резистентности исследованных линий фибробластов человека к ЦМВ не был связан с уровнями экспрессии мРНК IFNβ. Обсуждение В организме человека ЦМВ преимущественно находится в латентной форме. Активация ЦМВинфекции происходит на фоне иммунодефицитных состояний
    [2, 23]
    . ЦМВ обладает рядом механизмов иммуносупрессии и ускользания от иммунного ответа организма. Продукты генов US2, US3, US6, US11 вирусного генома интерферируют с процессингом и презентацией антигенов.
    (check this in PDF content)

  24. Start
    Дорожки: А – ФКЧ-1608 (1, 2 – 0 ч; 5, 6, 7 – 6 ч и 8 – 12 ч); ФЛЭЧ-977 (3, 4 – 0 ч; 9, 10, 11 – 6 ч и 12 – 12 ч); М – маркер ДНК 100-1000 н.п.; Б – ФЛЭЧ 977 (1, 2 – 24 ч; 3, 4 – 48 ч). Другие обозначения см. на рис. 3. но подавляет образование антигенных пептидов
    [20, 27]
    . Представленные данные впервые свидетельствуют о существовании в фибробластах человека IFN-зависимого транскрипционного механизма контроля развития ЦМВ-инфекции, в котором ведущая роль принадлежит генам IFNα.
    (check this in PDF content)

  25. Start
    При высокой множественности заражения покоящихся фибробластов почти все чувствительные клетки (88-97%) к 24 ч инфекции содержали вирусные белки IEp72 и рр65 и около 50% клеток – белок gB. На ранних сроках острой вирусной инфекции (заражение чувствительных к ЦМВ неделящихся фибробластов) ЦМВ наиболее сильно активировал транскрипцию генов IFNα и фермента 2`, 5`-ОАС
    . Значительно слабее и только кратковременно ЦМВ индуцировал синтез мРНК IFNβ и IFNγ. При этом стимуляция активности гена IFNγ позитивно коррелировала с клеточной резистентностью к ЦМВ, а повышенная экспрессия гена IFNβ, наоборот, – с чувствительностью клеток к вирусу.
    (check this in PDF content)

  26. Start
    При этом стимуляция активности гена IFNγ позитивно коррелировала с клеточной резистентностью к ЦМВ, а повышенная экспрессия гена IFNβ, наоборот, – с чувствительностью клеток к вирусу. Возможно, что разные штаммы ЦМВ отличаются IFN-индуцирующей активностью (в работе использован штамм AD169). По данным литературы
    , штамм Towne ЦМВ в чувствительной культуре фибробластах человека стимулировал транскрипцию гена IFNβ через 3 и 6 ч после заражения, при этом в культуральную среду секретировался биологически активный IFNβ.
    (check this in PDF content)

  27. Start
    [22], штамм Towne ЦМВ в чувствительной культуре фибробластах человека стимулировал транскрипцию гена IFNβ через 3 и 6 ч после заражения, при этом в культуральную среду секретировался биологически активный IFNβ. В стимуляции экспрессии гена IFNβ участвовали универсальный фактор NFκB и фосфатидилинозитол 3-киназа (PI3-K). Сверхранний вирусный белок IE86 эффективно блокировал индукцию IFNβ
    . Наиболее вероятными активаторами генов IFNα и IFNγ были вирионный белок gB (в условиях высокой множественности заражения) и сверхранний белок IE72, который образовывался в первые 3 ч острой ЦМВ-инфекции и способен индуцировать синтез IFN-регулируемых факторов транскрипции (IRF1, IRF3 и др.) [27,29].
    (check this in PDF content)

  28. Start
    Наиболее вероятными активаторами генов IFNα и IFNγ были вирионный белок gB (в условиях высокой множественности заражения) и сверхранний белок IE72, который образовывался в первые 3 ч острой ЦМВ-инфекции и способен индуцировать синтез IFN-регулируемых факторов транскрипции (IRF1, IRF3 и др.)
    . Однако последующее развитие острой ЦМВ-инфекции сопровождалось накоплением ингибиторов транскрипции генов IFNα. По нашим данным, к 24 ч инфекции в чувствительных линиях ФЛЭЧ в продуктах ЦМВ репликации содержались антагонисты генной активности IFNα.
    (check this in PDF content)

  29. Start
    В ЦМВ-геноме найден гомолог клеточного IL-10, который играет ключевую роль в контроле экспрессии генов IFN и антигенов главного комплекса гистосовместимости (HLA), подавляет пролиферацию лимфоцитов и моноцитов и продукцию ими провоспалительных цитокинов (TNFα, IL-1, IL-6)
    [21, 30]
    . По своему действию IL-10 относится к иммуносупрессивным лимфокинам. Установлено, что он подавляет ответ клеток на IFNα и IFNγ, блокируя транскрипционный фактор STAT1 путем активации казано, что белок IEp72 в ядрах инфицированных клеток, непосредственно взаимодействуя с факторами транскрипции STAT1 и STAT2, предотвращает их ассоциацию и фактора IRF9 с промоторами IFN-стимулированных генов
    (check this in PDF content)

  30. Start
    Установлено, что он подавляет ответ клеток на IFNα и IFNγ, блокируя транскрипционный фактор STAT1 путем активации казано, что белок IEp72 в ядрах инфицированных клеток, непосредственно взаимодействуя с факторами транскрипции STAT1 и STAT2, предотвращает их ассоциацию и фактора IRF9 с промоторами IFN-стимулированных генов
    . По механизму действия белок IEp72 имеет сходство с недавно открытым у мышиного ЦМВ белком M27 (79 kDa), который инактивирует сигнальную трансдукцию, вызываемую IFNγ с участием STAT2 [34]. Структурный вирусный белок рр65 (UL83), по данным литературы [7, 9], также способен оказывать ингибирующее действие на индукцию и экспрессию антивирусных генов.
    (check this in PDF content)

  31. Start
    , что белок IEp72 в ядрах инфицированных клеток, непосредственно взаимодействуя с факторами транскрипции STAT1 и STAT2, предотвращает их ассоциацию и фактора IRF9 с промоторами IFN-стимулированных генов [26]. По механизму действия белок IEp72 имеет сходство с недавно открытым у мышиного ЦМВ белком M27 (79 kDa), который инактивирует сигнальную трансдукцию, вызываемую IFNγ с участием STAT2
    . Структурный вирусный белок рр65 (UL83), по данным литературы [7, 9], также способен оказывать ингибирующее действие на индукцию и экспрессию антивирусных генов. Остается неизвестным, могут ли известные антагонисты антивирусного действия IFN (ингибиторы сигнальной трансдукции IFN-зависимых генов) неструктурный ранний вирусный белок IEp72 и основной структурный белок рр65, а также дсРНК-связы
    (check this in PDF content)

  32. Start
    По механизму действия белок IEp72 имеет сходство с недавно открытым у мышиного ЦМВ белком M27 (79 kDa), который инактивирует сигнальную трансдукцию, вызываемую IFNγ с участием STAT2 [34]. Структурный вирусный белок рр65 (UL83), по данным литературы
    [7, 9]
    , также способен оказывать ингибирующее действие на индукцию и экспрессию антивирусных генов. Остается неизвестным, могут ли известные антагонисты антивирусного действия IFN (ингибиторы сигнальной трансдукции IFN-зависимых генов) неструктурный ранний вирусный белок IEp72 и основной структурный белок рр65, а также дсРНК-связывающий белок TRSI и белок IRSI [16] негативно влиять на экспрессию ге
    (check this in PDF content)

  33. Start
    Остается неизвестным, могут ли известные антагонисты антивирусного действия IFN (ингибиторы сигнальной трансдукции IFN-зависимых генов) неструктурный ранний вирусный белок IEp72 и основной структурный белок рр65, а также дсРНК-связывающий белок TRSI и белок IRSI
    негативно влиять на экспрессию генов IFNα. По нашим данным, скорость и уровень синтеза вирусных белков IEp72 и рр65 в высокочувствительных клетках были значительно выше, чем в резистентных. Как стимулирующий, так и ингибиторный эффекты ЦМВ на экспрессию генов IFNα имели временную зависимость и прямо зависели от динамики синтеза каждого из этих белков.
    (check this in PDF content)

  34. Start
    Эти данные совместно с результатами недавно опубликованной работы вносят коррективы в представления о роли IFNβ, который называют также фибробластным, в защите диплоидных фибробластов человека от вирусной (по крайней мере, от цитомегаловирусной) инфекции
    . Таким образом, резистентность фибробластов человека к ЦМВ прямо коррелирует с конститутивным уровнем генной активности IFNα и сохранением его высокого уровня в процессе вирусной репликации. Ранее нами было показано, что в исследованных линиях клеток уровень репродукции ЦМВ зависит от активности гена IFN-зависимого фермента ОАС1 [5].
    (check this in PDF content)

  35. Start
    Таким образом, резистентность фибробластов человека к ЦМВ прямо коррелирует с конститутивным уровнем генной активности IFNα и сохранением его высокого уровня в процессе вирусной репликации. Ранее нами было показано, что в исследованных линиях клеток уровень репродукции ЦМВ зависит от активности гена IFN-зависимого фермента ОАС1
    . Сочетанное влияние ОАС, IFNα и IFNγ, по-видимому, является частью общего механизма ограничения репликации ЦМВ в фибробластах человека. Таким образом, развитие ЦМВ инфекции находится под контролем экспрессии генов лейкоцитарного и иммунного IFN.
    (check this in PDF content)